Jump to content

Coronavirus Mega-Thread.


Recommended Posts


100,000 Doctors & Medical Professionals Oppose COVID-19 Vaccine

Published on December 16, 2020

Written by Dr Andrew Kaufman



Doctors are now uniting against the pre planned and fabricated plandemic, which is quickly turning into a full genocidal push across the world.

Over 100,000 doctors and various health professionals have now united against the government planned genocide, with the pharmaceutical giants ready to start the slaughter in the long term care homes via an untested vaccine that purposely skipped animal trials.

The uninformed public is also targeted first and foremost, simply believing the government would never lie to them. The government is more than lying and these health professionals go on the record to document the government and media lies.

As the vaccine is set to kill and cripple the seniors and the uninformed in the first wave of genocide, their vaccine induced deaths and disease states will be used as the excuse to force the vaccine on everyone else, as the evil media and corrupt government will simply re-label the medical genocide as COVID-19 or something more deadly than COVID. This has been the plan the entire time.

You have a choice to make. You can face this evil or be consumed by it, there is no third option. Most people were purposely sent to government brain washing camps called “schools” where they were inserted with pro government brain washing mind control programming. This will make them unable to process what is happening and it will paralyze them from taking action. They will fall quickly.

You’ll need to decide if you will take action or simply be nudged inch by inch into the abattoir by peer pressure, paid government bullies, propaganda and a trail of safety bread crumbs…that lead right off a cliff.

There is no pandemic, the governments are faking the death counts (simply placing all deaths in the fabricated COVID category), all the governments are using a fraudulent RT-PCR machine to mark healthy people as infected (therefore driving a fear based case-demic of people who aren’t ill) plus the vaccine is designed to kill, cripple and/or cause infertility. Spread this video far and wide as these doctors and health professionals sound the alarm. This video has already been banned on Facebook and YouTube and is being denounced by media all over the world.

This video was produced by the team at Oracle Films and an INCREDIBLE line-up of brave, scientific and medical experts from around the world. With the COVID-19 Vaccine rollout beginning next week, we ask the one question on everybody’s minds….


Watch the Video on BNT here:

Read more at www.freedomman.org



  • Like 5
Link to comment
Share on other sites

The Scam Has Been Confirmed--PCR Does Not Detect SARS-CoV-2


Posted on:

Monday, December 14th 2020



Unofficial English translation of 'Frauds and falsehoods in the medical field' originally published on www.dsalud.com

The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose cases of illness and death attributed to Covid-19 are present in dozens of sequences of the human genome itself and in those of about a hundred microbes. And that includes the initiators or primers, the most extensive fragments taken at random from their supposed "genome" and even the so-called "target genes" allegedly specific to the "new coronavirus". The test is worthless and all "positive" results obtained so far should be scientifically invalidated and communicated to those affected; and if they are deceased, to their relatives. Stephen Bustin, one of the world's leading experts on PCR, in fact says that under certain conditions anyone can test positive!

We have been warning you since March: you cannot have specific tests for a virus without knowing the components of the virus you are trying to detect. And the components cannot be known without having previously isolated/purified that virus. Since then we continue to accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can never be isolated for the reasons we explained last month (read the report "Can you prove that there are pathogenic viruses?" on our website -www.dsalud.com-). And in the present report we are going to offer new data that show that RT-PCR does not detect the so called SARS-CoV-2 as it is known, but fragments of human RNA and those of numerous microbes.

We have already explained the numerous problems that RT-PCR poses, recognised by organisations or governments such as the WHO or the CDC and by prestigious international experts such as Dr. Stephen Bustin who considers both the arbitrariness of establishing criteria for results and the choice of the number of cycles to be nonsense because they can lead to anyone testing positive.

In this report we are going to add the results of a particular research we have done from the data published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of RT-PCR as well as the data corresponding to the rest of the "human coronaviruses". And the conclusions are extremely serious: none of the seven "human coronaviruses" have actually been isolated and all the sequences of the primers of their respective PCRs as well as those of a large number of fragments of their supposed genomes are found in different areas of the human genome and in genomes of bacteria and archaea, such as these: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis and a long list of others.

We are going to explain step by step the research that has led us to such an unusual conclusion.


During the first half of April, when the first research we conducted indicated that SARS-CoV-2 had not been isolated and since those who claimed to have done so were relying on "isolates" of previous "human coronaviruses", we began to do a thorough review of those claimed isolates. Specifically, we reviewed the alleged isolation work of suspected human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERSCoV (in 2012). And these have been the results:

Coronavirus 229E.

Reference article: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1:190-193. January 1, 1966.

Since the authors refer to other articles to explain the method of isolation - which they call Complement Fixation - we consulted a reference article for that method: that of Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5):931-938, May 1965. This is a procedure already in disuse that uses the antigen-antibody reaction to detect either one or the other. In the case we are dealing with, the aim was to detect the antigens of the supposed new virus but, as we have already explained, specific antibodies are needed which cannot be obtained the first time a virus is detected.

Coronavirus OC43.

Reference article: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub.

What was considered to be viral RNA was extracted from cultures without any proof that the RNA belongs to a virus. The tool used - a QIAamp kit - removes reagents, inhibitors and contaminants but what it cannot do is determine where the extracted RNA comes from. And there are no controls. It is then amplified by PCR and sequenced assuming (!) that it is genetic information of a virus. Finally, the author speculates about mutations, recombinations, genotypes, molecular evolution, strains and other jargon that conveys the idea -unproven- that a "virus" is being worked with.

SARS-CoV Coronavirus.

Reference article: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003.

There is no mention of purification in the article. There is not even any mention of filtration or centrifugation. It is only stated that "the viruses were isolated in fetal monkey liver cells from nasopharyngeal aspirates and lung biopsies of two patients". There are no controls. The only mention is of a "cytopathic effect" that is attributed to a virus and that PCR was done for known viruses and retroviruses without obtaining results. Finally, RT-PCR was done with "random initiators" and a sequence "of unknown origin" is detected to which "a weak homology with the coronaviridiae family" is found. Then they designed primers for that sequence and when testing 44 samples from SARS patients only 22 were positive.

Coronavirus NL63.

Reference article: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004.

The authors state that "the identification of unknown pathogens using molecular biology tools is difficult because the target sequence is not known so that PCR-specific initiators cannot be designed".

What they used is a tool they developed themselves called VIDISCA which, they claim, does not require prior knowledge of the sequence! Is that possible? Let's see how it works: first the culture is prepared and it is assumed that a virus is present due to the evidence of "cytopathic effect". The novelty introduced by this method is that "restriction enzymes" are added, enzymes that cut the nucleic acid molecules at certain locations and always by the same length. In this way, if after the action of these enzymes they observe many fragments of DNA or RNA that are the same or very similar, they deduce that it comes from a virus, since the host genome would present random cuts, while the virus genome presents a large number of copies that are the same due to the replication of the virus. And is such a deduction correct? Of course not! This assumption (which adds to the previous assumption that there is a virus) does not take into account that there are "virus-like particles", "retrovirus-like particles", "endogenous retroviruses", "exosomes", "extracellular" particles and even mitochondrial DNA. In denial, there are a multitude of particles that possess the same reproductive characteristics in large quantities as "viruses" and therefore can falsify results by producing large numbers of identical copies when cut by enzymes as recognised in an article on the VIDISCA technique entitled Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. It was published in volume 263 of Virus Research on April 2, 2019, and its authors-Cormac M. Kinsella et al.-recognise that "no redundancy is expected in the VIDISCA insert from the host background nucleic acid except in the case of 'virus-like' characteristics, i.e., high copy numbers as in mitochondrial DNA.

Coronavirus HKU1.

Reference article: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005.

The article, incredibly, begins with these words: "Despite extensive research in patients with respiratory tract infections, no microbiological cause has been identified in a significant proportion of patients. RNA is extracted from non-purified cultures." And a PCR with coronavirus genes is used. For the sequencing they use two protein databases organised in families, domains and functional sites -PFAM and INterProScan- combined with two computer programs that carry out "predictions" on how nucleotides should be combined. The text adds: "The sequences were manually assembled and edited to produce a final sequence of the viral genome". And once again there are no controls.

MERS-CoV Coronavirus.

Reference article: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012.

The genetic material is extracted directly from the culture supernatant and sputum sample with a tool called High Puré Viral Nucleic Acid Kit and then tested with different PCRs for various known microorganisms. There is no mention of purification and there are no controls.

In short, what had been done with the first coronaviruses -and with many other supposed viruses- is to cultivate supposedly infected tissues - any "cytopathic effect" was attributed to the presence of a virus only - and then either some proteins are obtained which without any test are considered "virus antigens" and when these "antigens" are detected in cultures it is interpreted as "isolation", or fragments of nucleic acids are extracted assuming that they belong to a virus.

We already explained in the article published in the previous issue of the magazine that according to Dr. Stefan Lanka the so-called "cytopathic effect" is actually an effect caused by the conditions of the culture itself. This is recognised for example in the article Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA published on August 15, 2017 on the website of Nature and signed by Andrea Németh and others

(https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf It explains that certain substances -such as antibiotics- added to in vitro experiments can stress the cell cultures so that they generate new sequences that had not been previously detected. This had already been noticed by none other than Dr. Barbara McClintock in 1983 during her Nobel Prize lecture, as can be seen at https://www.nobelprize.org/uploads/2018/06/mcclintock-lecture.pdf

In essence, NOT ONE OF THE SEVEN SUPPOSED HUMAN CORONAVIRUS HAS REALLY BEEN ISOLATED. The only thing that has been different between them are the laboratory procedures and techniques that were becoming progressively more sophisticated which, in this case, has implied not a greater accuracy but a greater capacity for deception and self-deception that has culminated in the virtual manufacture of the SARS-CoV-2.

And the obvious consequence of the lack of evidence of its isolation is that such "coronaviruses" cannot be held responsible for any disease. Moreover, all tests - of whatever kind - based on the presumed components of these "viruses" (nucleic acids or proteins) are completely disqualified as "infection tests" and even more as "diagnostics" of diseases.


In the previous issue we already collected the answers given by the authors of several articles that supposedly described the isolation of SARS-CoV-2 in which they acknowledged that they had not "purified" which implicitly means acknowledging that the virus was not isolated. And now we are going to add one more piece of evidence: the responses given by different authorities - political and health - from various countries about the purification and isolation of SARS-CoV-2.

James McCumiskey -author of the book The Latest Conspiracy: The Biomedical Paradigm- tells us that the National Virus Reference Laboratory of Ireland requested information about it from the University of Dublin and the latter responded that "it has no records that could provide an answer to their request". The director of legal services of the laboratory insisted on his request to the university and the university responded as follows: "The position of the university is that material of academic debate cannot be subject to the Freedom of Information Act". It follows from the NVR's request that they have not cultivated SARS-CoV-2 or purified it. They only acknowledge having "detected SARS-CoV-2 RNA in diagnostic samples."

On June 22, a group of experts sent a consultation in similar terms to British Prime Minister Boris Johnson. The letter was signed by Dr. Kevin Corbett, Piers Corbyn - professor at Imperial College London -, the engineer and independent researcher - who we interviewed in the journal at the time - David Crowe, Dr. Andrew Kaufman, the Edinburgh professor of biology Roger Watson and the biologist and chemist David Rasnick - and to this day they still have not received a reply!

Another similar request - in this case to the National Research Council of Canada - received the following response: "We have not been able to carry out a complete search of the NRC's records so we regret to inform you that no records have been identified that respond to your request."

We will add that two journalists have been sending similar requests - under the Freedom of Information Act - to various institutions in Canada, New Zealand, Australia, Germany, the United Kingdom and the United States, and as of September 5, twelve institutions have responded, all indicating the same thing: that they have no record of work describing the isolation of the virus that is supposed to cause Covid-19. The details and the answers can be seen at



The question we asked ourselves then was: if the sequences that have been published do not belong - as claimed- to new viruses, where do they come from? And to try to answer that question we decided to carry out a search with a computer program called Basic Local Alignment Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given sequence with all the sequences stored in the National Institutes of Health of the United States (it is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by step what we did so that our readers can repeat the search for themselves and check the results.

First we collected all the initiators of the PCRs described in the protocols hosted on the WHO website at the time which were these:

  • China CDC protocol: uses ORF1ab and N genes as target.

  • Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to be SARS.CoV-2 specific).

  • United States CDC protocol: uses three fragments of the N gene.

  • Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as target the S gene together with other genes supposedly shared with other coronaviruses.

  • Charite Protocol (Germany): uses the E, N and RdRP genes.

  • Hong Kong University Protocol: uses ORF1b-nsp14 and N gene.

  • National Institute of Health Thailand protocol: uses the N gene.

We then introduced the sequence of the primers - the one that indicates the beginning of the sequence to be detected (forward) and the one that indicates the final (reverse) - into the BLAST so that it could search for them in two databases: a collection of microbe genomes and the one corresponding to the human genome.


Let's see in detail the procedure taking as an example the initiators of the French protocol. Once on the BLAST website, we chose Microbes to search the microbial genome databases and moved to the next page. Then a form appeared in which we entered the sequence of the forward initiator of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similar sequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a screenshot (image 1)- and we were shown 100 sequences of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%.

We then returned to the home page and that second time we chose Human to search the human genome, we repeated the same operation and after a few seconds the result appeared which we screen captured again (image 2). And it turns out that the sequence entered coincides with 74 sequences of the human genome, with a coincidence of between 66% and 100% and a percentage of identity of 100%.

And that indicates that the sequence of that initial PCR primer that is supposed to be specific to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred microbial fragments as well!

We then decided to repeat the operation but with the final or reverse primer - which is CTCCCTTTGTGTGTGT - and the results were similar.

Since these were very short sequences -about twenty genetic letters or nucleotides- we decided to try again but with the target sequence defined by these two primers, i.e. the sequence of the supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously, for this we needed the sequence that is officially claimed to be the "SARS-CoV-2 genome" and although thousands of laboratories claim to have isolated and sequenced it -a false claim as we have explained in previous reports- we decided to go to the National Centre for Biotechnology Information website: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2?report=genbank&to=29903. Once there, we located the "target sequence", a fragment of 108 nucleotides located between positions 12,690 and 12,797 of the "genome", which is this one:


With this we repeated the steps previously described and the results were again surprising since there appeared again a hundred microbe sequences with a percentage of a match of 100% and four sequences of the human genome with an identity percentage between 83% and 95%. The matches were therefore lower but the important thing is that we continue to find fragments of the supposed "target sequence" of SARS-CoV-2 both in microbes and in our own genome.

Truly astonished we took a further step and tested with the gene considered at that time as the most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472:


We repeated with it the steps already described and the result was even more surprising because despite its length another hundred microbe sequences appeared with a percentage of identity of 100% and 10 sequences of the human genome with a percentage of identity between 80% and 100%. And similar results were obtained with a fragment chosen at random and with the N gene which they say corresponds to the proteins of the SARS-CoV-2 nucleocapsid.

We finally decided to test with the S gene which is said to generate the structural "spike" proteins that are key to entry into the cell and was subsequently considered to be the most specific SARS-CoV-2 gene. Since it is a gene whose sequence is much longer - 3821 nucleotides between positions 21,563 and 25,384 - we tested with two fragments chosen at random within that gene and the first - TTGGCAAAATTCAAGACTCACTTTC - resulted in another hundred microbe sequences and 93 sequences of the human genome and the second - CTTGCTGCTACTAAATGCAGAGTGT - a hundred microbial sequences and 90 of the human genome.

Finally we decided to test with the initiators of the Japan Protocol, the only one that includes target sequences of the S gene and, the reader will have already guessed, the results were once

again similar: a hundred microbe sequences and 93 sequences of the human genome with an identity percentage between 94.12% and 100%!


The consequence of all that we have just explained is clear and immediate: THERE IS NO VALID TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. And that means that

ALL THE NUMBERS OF "CASES", "INFECTED", “SICK", "Asymptomatic" OR "DEAD DUE TO COVID-19" LACK A SCIENTIFIC BASE AND ALL “POSITIVES" ARE FALSE POSITIVES, something that should be communicated immediately to those affected and those responsible should be held accountable.

We end by adding that even the WHO itself does not really believe in these tests. Just read the document published last September 11 as a laboratory guide for SARS-CoV-2 entitled Diagnostic tests for SARS-CoV-2 - it is available at https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve - and it literally says on page 5: "Whenever possible, suspected active infection should be tested with a nucleic acid amplification test (NAAT) such as RT-PCR. NAAT tests should target the SARS-CoV-2 genome but since there is no known global circulation of SARS-CoV-1 a Sarbecovirus sequence (presumed to include at least five human and animal coronaviruses including SARS-CoV-1 and SARS-Cov-2) is also a reasonable target". That is, WHO agrees to use non-specific sequences to detect SARS-CoV-2.

That is not all because the manual later states, "An optimal diagnosis consists of a NAAT test with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used."

The WHO manual states, "One or more negative results do not necessarily rule out SARS-CoV-2 infection. There are a number of factors that can produce a negative result in an infected individual including poor quality of the sample, late collection of the sample, inadequate handling, or technical reasons inherent in the test, such as mutation of the virus or inhibition of PCR."

What are the judges waiting for to act on their own initiative?

Jesus Garcia Blanca

Note: the author publicly thanks Juan Pedro Aparicio Alcaraz for his patient and meticulous collaborative work in the search for scientific articles and for his tedious work with the BLAST.

THIS REPORT APPEARS IN (https://www.dsalud.com/revistas/numero-242-noviembre-2020/)


  • Like 2
  • Thanks 1
Link to comment
Share on other sites

2 hours ago, eddy64 said:

well they have supposed to have vaccinated about 140,000 in the uk atm. 


England: 108,000

Wales: 7,897

Northern Ireland: 4,000

Scotland: 18,000


and when they have adverse reactions to the vaccines it will be blamed on a 'mutated strain of virus' creating a 'third wave' requiring more lockdowns and more vaccinations...

Edited by Macnamara
  • Like 2
Link to comment
Share on other sites

"... the signs of the door of Edinburgh General Hospital’s implored people to “join the resistance, get vaccinated”, while elsewhere, in Newcastle, there were “I’ve had my Covid vaccination” stickers on offer to the lucky first patients."


Link to comment
Share on other sites

16 hours ago, EnigmaticWorld said:


No reactions, but let's hope so mate. This might be the biggest test for humanity so far, assuming we haven't been through a reset on this scale before.



Interesting and terrifying thought 😬



15 hours ago, zarkov said:

The term "conspiracy theorist" really grates sometimes, when the reality is that they are the canary's in the coal mine.

Even before the term was psyoped supposedly by the cia post kennedy assasination. It really dealt a death blow to telling the truth or genuine concern and consequent investigation.

One weaponised use of the term "conspiracy theorist" deflates and ridicules all arguments in the public perception.

Why thinking people allowed a term to be weaponised against our collective selves.

So surely collecively we could create a term that causes less consternation?



Totally agree.  But I also hate the term 'sheep'.  I think it's degrading and generic and it's used too much here, when we should maybe be showing more empathy, as frustrating as the woolly little bastards are...


The term I hate the most is the Elite as they are far from it.

  • Like 4
Link to comment
Share on other sites

1 hour ago, Macnamara said:


and when they have adverse reactions to the vaccines it will be blamed on a 'mutated strain of virus' creating a 'third wave' requiring more lockdowns and more vaccinations...


Unfortunately I think it's likely to be more devious than that, it'll be blamed on us for being "anti-vax" and continuing to spread the disease, thereby preventing everyone from returning to normal life

  • Like 4
Link to comment
Share on other sites

Professor calls for support of free expression after getting told to stop teaching over anti-mask comments


Facebook now sending notifications that encourage users to leave groups that post coronavirus “misinformation”


Link to comment
Share on other sites

29 minutes ago, Noctua said:



Interesting and terrifying thought 😬




Totally agree.  But I also hate the term 'sheep'.  I think it's degrading and generic and it's used too much here, when we should maybe be showing more empathy, as frustrating as the woolly little bastards are...


The term I hate the most is the Elite as they are far from it.


Out of likes as usual - another coronanvirus restriction ;)


"Woolly little bastards" sounds like a great alternative  hilarious LOL  - Laughing aside, I quite agree. TBH I dont like to denigrate people either but frustration, anxiety etc ... its been such a wonderful year!

Lemmings conjures the appropriate mental peturbation but Im labelling again!


Elite - I dont use that one prefering globalist,  but parasites is one that I have used often as it aptly describes them, past and present.


One that I heard that makes me chuckle is "cunting bastards"  as applied to the parasite class.


Ive a book called Foyles Filavery which is a dictionary of infrequently encountered words. One of my favourites from it is the term "Kakistocracy" which is self explanitory  Kak - shite obviously.


Fits with the state of non-democracy we observe today! which has nothing to do with voting. Mob rule!







Edited by zarkov
  • Like 2
Link to comment
Share on other sites

Great Reset: 61% Of Nations Have Decimated Liberty With COVID Restrictions


'The International Institute for Democracy and Electoral Assistance (IDEA), based in Sweden, reports that 61 per cent of countries have used restrictions “that were concerning from a democracy and human rights perspective.”

‘These [restrictions] violated democratic standards because they were either disproportionate, illegal, indefinite or unnecessary in relation to the health threat,” the group declared in its report.'





  • Thanks 1
Link to comment
Share on other sites

With the introduction of these lateral flow tests for kids in schools a lot of us parents are going to be faced with some hard decisions in the future. I am lucky as at least Im in a position to home school my lad. I have mentioned the possibility to him and he doesnt fancy it as of course he will miss his friends etc. However by leaving our kids in schools we will just enable them to ramp up the testing and fake the numbers, it will be a tough call for many awake parents

Link to comment
Share on other sites

wrt the talkradio tobias ellwood clip



Tobias Ellwood talks crap.


The parasites had to redefine the term "Pandemic" to call this a pandemic



I jotted the following down a couple of weeks ago but didnt post it 


From the ONS website




Mortality in the United Kingdom: 1983-2013

2.Total deaths

The number of deaths registered in the United Kingdom (UK) in 2013 was 576,458, an overall reduction of 13% from the total number of deaths (659,101) registered in the UK 30 years ago. The number of deaths declined for both men and women between 1983 and 2013, by 15% for males and 10% for females. These declines have occurred despite the overall increase in population and the ageing of the population. However there have been slight increases in the number of deaths over the last couple of years, due to the increase in and ageing of the population.




According to ons figures for 2020 there have been 517,674 Deaths so far.



In 1983 the population was 56,276,791

In 2013 the population was 64,984,015 


Giving a mortality rate of 1.17% & 0.88% of the population at the time, respectively.


For 2020 the current mortality rate for the present population of 67,886,004 is 0.76% (with a further ~8 weeks till year end to add to this figure)

However the overall decline in all cause mortality is notable - 


To acheive the same all cause mortality rate as 2013 in 2020 a further 79,722 all cause deaths would be expected by year end, which will most likey be the tally by year end.

To acheive  the same all cause mortality rate as 1983 in 2020 a further 276,592 all cause deaths would be expected by year end.  (adjusted for population)


Around 10500 people die each week on average in the UK


So why the hysteria? These were not unusual years and all cause mortality was generally greater than now, and moreso the further back we look.

The media didnt spin so fast back then!


The hong kong flu which resulted proportionally in twice the mortality we have today.

Asian flu an estimated 33,000 deaths in the United Kingdom were attributed to the 1957–58 flu outbreak. The estimated number of deaths was 1.1 million worldwide and 116,000 in the United States. Link link
Population in 1957 was 51,495,702 in the UK, 177,751,476 in the USA and the global population was 2,873,306,058.

If the population during asian flu had 6.8 Billion then 2,603,273 would have been the estimated number of deaths. 

Clearly, when straightforward perspective is applied there is nothing out of the ordinary occurring world-wide that has not been far worse previously, in recent living memory.

Since our collective authorities, as experts in all areas as displayed in their current interventions, have access to all information since that is their expertise and their jobs require that they are, they are fully aware of this vastly disproportionate over reaction to what is an ordinary seasonal occurrence.

What is abundantly clear is that this co-coordinated global imposition was not required or necessary for this non emergency.
Therefore the reasoning for its purpose lies elsewhere.
The united nations agenda for the 21st century requires that travel be restricted, trade be restricted, access to countryside be restricted and that the re-wilding of the countryside take place. The building of smart cities and towns and wireless interconnectivity like never before to solve all the new problems like pestilence, toxic pollution, famine and economic ruin, artificial energy scarcity, man made global warming and pseudo-pandemics.

They have been working hard all these years in the background providing solutions to each and every one of these “problems” and as if by magic these solutions are mysteriously appearing. To add insult to injury they also performed a well publicised dress rehearsal called event 201 where the global community participated in a complete co-ordinated global lockdown.

Anyone who runs a business knows that nothing occurs in any co-ordinated fashion unless a great deal of planning takes place beforehand.



The virus has taken on the same magical status as CO2


Edited by zarkov
  • Like 5
Link to comment
Share on other sites

  • lake locked this topic
  • lake unlocked this topic
  • Beaujangles featured this topic

Join the conversation

You can post now and register later. If you have an account, sign in now to post with your account.
Note: Your post will require moderator approval before it will be visible.

Reply to this topic...

×   Pasted as rich text.   Paste as plain text instead

  Only 75 emoji are allowed.

×   Your link has been automatically embedded.   Display as a link instead

×   Your previous content has been restored.   Clear editor

×   You cannot paste images directly. Upload or insert images from URL.


  • Create New...