Macnamara Posted December 16, 2020 Share Posted December 16, 2020 (edited) On 12/15/2020 at 12:04 PM, sherbet said: Could someone clarify, DOES THIS VIRUS EXIST OR NOT as this is adding to all the confusion out there The claim of the government is that we are in the throes of a deadly pandemic. This should mean that the overall death figures for this year would then be substantially higher than previous years to indicate a mass die off as you would expect in a pandemic However we do have the problem when looking at those figures that the lockdowns themselves are causing deaths for example through people not getting treatments and diagnoses that they would normally be getting and also through older patients being given do-not-resussitate orders and also with suicides. Also the effect of the stress of the situation as well as locking people in their homes during and at the end of the flu season will itself have a negative effect on health as they won't receive the vitamin D and warmth of human interaction that they would otherwise get. The government has stopped publishing the suicide figures which then obviously masks that as a factor. So when we talk about 'excess deaths' we need to consider that many deaths will have been caused by the lockdowns themselves. So then we have the problem that many deaths are being attributed to 'covid' that are actually due to other things. Initially these were reported as deaths 'with' covid and not 'of' covid but they are being recorded as covid deaths. As covid figures have risen, flu and pneumonia figures have fallen suggesting that people who are dying of flu and pneumonia as is normal during the winter time are now being labelled as 'covid' deaths thereby skewing the figures This skewing of the figures is being enabled by the use of the PCR test which a public health england document admits cannot determine the presence of an infectious virus. the test is not identifying a complete virus genome, it just gets snippets of genetic material which are all found in the human body anyway and then these are being claimed to be part of a new virus Even the politicians themselves have admitted on live TV that the PCR tests produce many false positives but if we go with the official figures they are saying that the alleged virus has a survival rate, if you are under 70 of 99.98% which is comparable to the flu at 99.99% So the question then is, from a public health perspective as well as an economic one, whether it is proportional and reasonable to lock people down over something that is comparable to the flu? We can go deeper still and ask if it is even ethical to impose restrictions on people that are a complete breach of their common law rights of free movement and free association Edited December 16, 2020 by Macnamara 1 Quote Link to comment Share on other sites More sharing options...
Ethel Posted December 16, 2020 Share Posted December 16, 2020 On 12/15/2020 at 12:04 PM, sherbet said: Could someone clarify, DOES THIS VIRUS EXIST OR NOT 12 hours ago, sherbet said: I am a health professional who has been researching C19 since it's inception 1 Quote Link to comment Share on other sites More sharing options...
Mr H Posted December 16, 2020 Share Posted December 16, 2020 This is the thing I am not sure about either. I listened to Kauffman etc. And they make a persuasive argument. But they are persuading someone who has zero knowledge of the subject matter. Seems to all hinge around these Kochs postulates, but it's my understanding that these aren't regularly used or can't be used to identify viruses. Which then leads down to the whole virus theory itself................I am not in a position to make any conclusions on that one when far greater minds than mine have been debating that theory for a very long time. So to be honest I have no idea how important and how commonly used in virology these postulates are - but can appreciate in an ideal world they would always be used - but as we know perfect standards are not regularly used in many things - so no surprise........ What I do know is that because of my above confusion I asked Public Health England whether they have evidence of causation between death and co-vid 19 - they said they didn't know. So that to me is a red flag. I do also know people who have been quite ill with the disease and my dad died with the disease earlier this year. So from my experience there is definitely something going around - that wasn't around before. Is it corona? Is it something else? I just can't make that conclusion. Quote Link to comment Share on other sites More sharing options...
Mr H Posted December 16, 2020 Share Posted December 16, 2020 What you really need here and on a lot of these things is someone like Kauffman having a debate with this with someone from the otherside in real time. Then it would be easier to make a conclusion. People don't like doing debates it seems. Quote Link to comment Share on other sites More sharing options...
Macnamara Posted December 17, 2020 Share Posted December 17, 2020 2 hours ago, Mr H said: This is the thing I am not sure about either. I listened to Kauffman etc. And they make a persuasive argument. But they are persuading someone who has zero knowledge of the subject matter. Seems to all hinge around these Kochs postulates, but it's my understanding that these aren't regularly used or can't be used to identify viruses. Which then leads down to the whole virus theory itself................I am not in a position to make any conclusions on that one when far greater minds than mine have been debating that theory for a very long time. So to be honest I have no idea how important and how commonly used in virology these postulates are - but can appreciate in an ideal world they would always be used - but as we know perfect standards are not regularly used in many things - so no surprise........ What I do know is that because of my above confusion I asked Public Health England whether they have evidence of causation between death and co-vid 19 - they said they didn't know. So that to me is a red flag. I do also know people who have been quite ill with the disease and my dad died with the disease earlier this year. So from my experience there is definitely something going around - that wasn't around before. Is it corona? Is it something else? I just can't make that conclusion. sorry to hear about your dad, i had a relative in hospital with thickening blood so i'm looking for a factor too one of the most compelling leads i have found is that the flu vaccine can make peoples immune systems turn on themselves through viral interference do you know if your dad had a flu jab at any point? Quote Link to comment Share on other sites More sharing options...
Macnamara Posted December 17, 2020 Share Posted December 17, 2020 (edited) 2 hours ago, Mr H said: What you really need here and on a lot of these things is someone like Kauffman having a debate with this with someone from the otherside in real time. Then it would be easier to make a conclusion. People don't like doing debates it seems. Dr Andrew Kaufman on the Frankenstein synthetic biology paper in 2007 that preceded current vaccine events: Dr Kaufman: ‘They basically created synthetic exosomes with longer RNA sequences containing several genes they attribute to various fake viruses which are associated with diseases like hepatitis C and SARS. This is a so-called chimera. If this were included in a vaccine, i.e. injected, it could cause all sorts of health issues. It is basically an RNA vaccine that will make our own cells express these “virus” genes. The consequences of this are unknown but ominous.’ Virology RNase-Resistant Virus-Like Particles Containing Long Chimeric RNA Sequences Produced by Two-Plasmid Coexpression System Yuxiang Wei, Changmei Yang, Baojun Wei, Jie Huang, Lunan Wang, Shuang Meng, Rui Zhang, Jinming Li DOI: 10.1128/JCM.02248-07 https://jcm.asm.org/content/46/5/1734 Edited December 17, 2020 by Macnamara 1 Quote Link to comment Share on other sites More sharing options...
Macnamara Posted December 17, 2020 Share Posted December 17, 2020 Unofficial English translation of ‘Frauds and falsehoods in the medical field’ https://www.dsalud.com/reportajes/fraudes-y-falsedades-en-el-ambito-medico/ The scam has been confirmed: PCR does not detect SARS-CoV-2 Number 242 - November 2020 Reading time: 15 minutes _______________________________________________________________________________________ The genetic sequences used in PCRs to detect suspected SARS-CoV-2 and to diagnose cases of illness and death attributed to Covid-19 are present in dozens of sequences of the human genome itself and in those of about a hundred microbes. And that includes the initiators or primers, the most extensive fragments taken at random from their supposed "genome" and even the so-called "target genes" allegedly specific to the "new coronavirus". The test is worthless and all "positive" results obtained so far should be scientifically invalidated and communicated to those affected; and if they are deceased, to their relatives. Stephen Bustin, one of the world's leading experts on PCR, in fact says that under certain conditions anyone can test positive! We have been warning you since March: you cannot have specific tests for a virus without knowing the components of the virus you are trying to detect. And the components cannot be known without having previously isolated/purified that virus. Since then we continue to accumulate evidence that no one has isolated SARS-CoV-2 and, more importantly, that it can never be isolated for the reasons we explained last month (read the report "Can you prove that there are pathogenic viruses?" on our website -www.dsalud.com-). And in the present report we are going to offer new data that show that RT-PCR does not detect the so called SARS-CoV-2 as it is known, but fragments of human RNA and those of numerous microbes. We have already explained the numerous problems that RT-PCR poses, recognised by organisations or governments such as the WHO or the CDC and by prestigious international experts such as Dr. Stephen Bustin who considers both the arbitrariness of establishing criteria for results and the choice of the number of cycles to be nonsense because they can lead to anyone testing positive. In this report we are going to add the results of a particular research we have done from the data published on the alleged SARS-CoV-2 and on the protocols endorsed by the WHO for the use of RT-PCR as well as the data corresponding to the rest of the "human coronaviruses". And the conclusions are extremely serious: none of the seven "human coronaviruses" have actually been isolated and all the sequences of the primers of their respective PCRs as well as those of a large number of fragments of their supposed genomes are found in different areas of the human genome and in genomes of bacteria and archaea, such as these: Shwanella marina JCM, Dialister succinatiphilus, Lactobacillus porcine, Lactobacillus manihotivorans, Leptospira sarikeiensis, Bizionia echini, Sanguibacteroides justesenil, Bacteroides massiliensis, Lacinutrix venerupis, Moraxella bovis, Leptospira saintgironsiae, Winogradskyella undariae, Acetobacterium puteale, Chryseobacterium hispanicum, Paenibacillius koleovorans, Tamiana fuccidanivorans, Fontibacillua panacisegetis, Ru bacter ruber , Skemania piniformis, Chryseobacterium shigense, Caloramator peoteoclasticus, Cellulosilyticum ruminicola, Nitrosopumilius evryensis and a long list of others. We are going to explain step by step the research that has led us to such an unusual conclusion. HAVE ANY HUMAN CORONAVIRUSES BEEN ISOLATED? During the first half of April, when the first research we conducted indicated that SARS-CoV-2 had not been isolated and since those who claimed to have done so were relying on "isolates" of previous "human coronaviruses", we began to do a thorough review of those claimed isolates. Specifically, we reviewed the alleged isolation work of suspected human coronaviruses 229E (said to have been isolated in 1965), OC43 (in 1967), SARS-CoV (in 2003), NL63 (in 2004), HKU1 (in 2005) and MERSCoV (in 2012). And these have been the results: Coronavirus 229E. Reference article: Dorothy Hamre and John Procknow. A new virus isolated from the human respiratory Tract. Proceedings of the Society for Experimental Biology and Medicine, 121: 1: 190-193. January 1, 1966. Since the authors refer to other articles to explain the method of isolation - which they call Complement Fixation - we consulted a reference article for that method: that of Janet W. Hartley et al. Complement Fixation and tissue culture assay for mouse leukaemia viruses PNAS, 53(5): 931-938, May 1965. This is a procedure already in disuse that uses the antigen-antibody reaction to detect either one or the other. In the case we are dealing with, the aim was to detect the antigens of the supposed new virus but, as we have already explained, specific antibodies are needed which cannot be obtained the first time a virus is detected. Coronavirus OC43. Reference article: Paul Lee. Molecular epidemiology of human coronavirus OC43 in Hong Kong. Thesis for the Department of Microbiology, University of Hong Kong, August 2007. The HKU Scholars Hub. What was considered to be viral RNA was extracted from cultures without any proof that the RNA belongs to a virus. The tool used - a QIAamp kit - removes reagents, inhibitors and contaminants but what it cannot do is determine where the extracted RNA comes from. And there are no controls. It is then amplified by PCR and sequenced assuming (!) that it is geneticinformation of a virus. Finally, the author speculates about mutations, recombinations, genotypes, molecular evolution, strains and other jargon that conveys the idea -unproven- that a "virus" is being worked with. SARS-CoV Coronavirus. Reference article: J. S. M. Peiris and others. Coronavirus as a possible cause of SARS. Lancet 361: 1319-25, April 2003. There is no mention of purification in the article. There is not even any mention of filtration or centrifugation. It is only stated that "the viruses were isolated in fetal monkey liver cells from nasopharyngeal aspirates and lung biopsies of two patients". There are no controls. The only mention is of a "cytopathic effect" that is attributed to a virus and that PCR was done for known viruses and retroviruses without obtaining results. Finally, RT-PCR was done with "random initiators" and a sequence "of unknown origin" is detected to which "a weak homology with the coronaviridiae family" is found. Then they designed primers for that sequence and when testing 44 samples from SARS patients only 22 were positive. Coronavirus NL63. Reference article: Lia van der Hock and others. Identification of a new human coronavirus. Nature Medicine, 10, 4 April 2004. The authors state that "the identification of unknown pathogens using molecular biology tools is difficult because the target sequence is not known so that PCR-specific initiators cannot be designed". What they used is a tool they developed themselves called VIDISCA which, they claim, does not require prior knowledge of the sequence! Is that possible? Let's see how it works: first the culture is prepared and it is assumed that a virus is present due to the evidence of "cytopathic effect". The novelty introduced by this method is that "restriction enzymes" are added, enzymes that cut the nucleic acid molecules at certain locations and always by the same length. In this way, if after the action of these enzymes they observe many fragments of DNA or RNA that are the same or very similar, they deduce that it comes from a virus, since the host genome would present random cuts, while the virus genome presents a large number of copies that are the same due to thereplication of the virus. And is such a deduction correct? Of course not! This assumption (which adds to the previous assumption that there is a virus) does not take into account that there are "virus-like particles", "retrovirus-like particles", "endogenous retroviruses", "exosomes", "extracellular" particles and even mitochondrial DNA. In denial, there are a multitude of particles that possess the same reproductive characteristics in large quantities as "viruses" and therefore can falsify results by producing large numbers of identical copies when cut by enzymes as recognised in an article on the VIDISCA technique entitled Enhanced bioinformatic proSling of VIDISCA libraries for virus detection and Discovery. It was published in volume 263 of Virus Research on April 2, 2019, and its authors-Cormac M. Kinsella et al.-recognise that "no redundancy is expected in the VIDISCA insert from the host background nucleic acid except in the case of 'virus-like' characteristics, i.e., high copy numbers as in mitochondrial DNA. Coronavirus HKU1. Reference article: Patrick C. Y. Woo and others. Characterisation and Complete Genome Sequence of a Novel Coronavirus, Coronavirus HKU1, from Patients with Pneumonia. Journal of Virology, 79, 2, January 2005. The article, incredibly, begins with these words: "Despite extensive research in patients with respiratory tract infections, no microbiological cause has been identified in a significant proportion of patients. RNA is extracted from non-purified cultures.” And a PCR with coronavirus genes is used. For the sequencing they use two protein databases organised in families, domains and functional sites -PFAM and INterProScan- combined with two computer programs that carry out "predictions" on how nucleotides should be combined. The text adds: "The sequences were manually assembled and edited to produce a final sequence of the viral genome". And once again there are no controls. MERS-CoV Coronavirus. Reference article: Ali Moh Zaki and others. Isolation of a Novel Coronavirus from a Man with Pneumonia in Saudi Arabia. The New England Journal of Medicine, 367:19, November 2012. The genetic material is extracted directly from the culture supernatant and sputum sample with a tool called High Puré Viral Nucleic Acid Kit and then tested with different PCRs for various known microorganisms. There is no mention of purification and there are no controls. In short, what had been done with the first coronaviruses -and with many other supposed viruses- is to cultivate supposedly infected tissues - any "cytopathic effect” was attributed to the presence of a virus only - and then either some proteins are obtained which without any test are considered "virus antigens" and when these "antigens" are detected in cultures it is interpreted as "isolation", or fragments of nucleic acids are extracted assuming that they belong to a virus. We already explained in the article published in the previous issue of the magazine that according to Dr. Stefan Lanka the so-called "cytopathic effect" is actually an effect caused by the conditions of the culture itself. This is recognised for example in the article Antibiotic-induced release of small extracellular vesicles (exosomes) with surface-associated DNA published on August 15, 2017 on the website of Nature and signed by Andrea Németh and others (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5557920/pdf/41598_2017_Article_8392.pdf It explains that certain substances -such as antibiotics- added to in vitro experiments can stress the cell cultures so that they generate new sequences that had not been previously detected. This had already been noticed by none other than Dr. Barbara McClintock in 1983 during her Nobel Prize lecture, as can be seen at https://www.nobelprize.org/uploads/2018/06/mcclintock- lecture.pdf In essence, NOT ONE OF THE SEVEN SUPPOSED HUMAN CORONAVIRUS HAS REALLY BEEN ISOLATED. The only thing that has been different between them are the laboratory procedures and techniques that were becoming progressively more sophisticated which, in this case, has implied not a greater accuracy but a greater capacity for deception and self-deception that has culminated in the virtual manufacture of the SARS-CoV-2. And the obvious consequence of the lack of evidence of its isolation is that such "coronaviruses" cannot be held responsible for any disease. Moreover, all tests - of whatever kind - based on the presumed components of these "viruses" (nucleic acids or proteins) are completely disqualified as "infection tests" and even more as "diagnostics" of diseases. MORE UNANSWERED REQUESTS In the previous issue we already collected the answers given by the authors of several articles that supposedly described the isolation of SARS-CoV-2 in which they acknowledged that they had not "purified" which implicitly means acknowledging that the virus was not isolated. And now we are going to add one more piece of evidence: the responses given by different authorities - political and health - from various countries about the purification and isolation of SARS-CoV-2. James McCumiskey -author of the book The Latest Conspiracy: The Biomedical Paradigm- tells us that the National Virus Reference Laboratory of Ireland requested information about it from the University of Dublin and the latter responded that "it has no records that could provide an answer to their request". The director of legal services of the laboratory insisted on his request to the university and the university responded as follows: "The position of the university is that material of academic debate cannot be subject to the Freedom of Information Act". It follows from the NVR's request that they have not cultivated SARS-CoV-2 or purified it. They only acknowledge having "detected SARS-CoV-2 RNA in diagnostic samples.” On June 22, a group of experts sent a consultation in similar terms to British Prime Minister Boris Johnson. The letter was signed by Dr. Kevin Corbett, Piers Corbyn - professor at Imperial College London -, the engineer and independent researcher - who we interviewed in the journal at the time - David Crowe, Dr. Andrew Kaufman, the Edinburgh professor of biology Roger Watson and the biologist and chemist David Rasnick - and to this day they still have not received a reply! Another similar request - in this case to the National Research Council of Canada - received the following response: "We have not been able to carry out a complete search of the NRC's records so we regret to inform you that no records have been identified that respond to your request.” We will add that two journalists have been sending similar requests - under the Freedom of Information Act - to various institutions in Canada, New Zealand, Australia, Germany, the United Kingdom and the United States, and as of September 5, twelve institutions have responded, all indicating the same thing: that they have no record of work describing the isolation of the virus that is supposed to cause Covid-19. The details and the answers can be seen at https://www.fluoridefreepeel.ca/u-k-dept-of-health-and-social-care-has-no-record-of- covid-19-virus-isolation/LOOKING FOR THE ORIGIN OF THE FALSE GENOME The question we asked ourselves then was: if the sequences that have been published do not belong - as claimed- to new viruses, where do they come from? And to try to answer that question we decided to carry out a search with a computer program called Basic Local Alignment Search Tool (BLAST), a sequence alignment search tool that allows us to compare a given sequence with all the sequences stored in the National Institutes of Health of the United States (it is public and can be consulted at https://blast.ncbi.nlm.nih.gov/Blast.cgi. We explain step by step what we did so that our readers can repeat the search for themselves and check the results. First we collected all the initiators of the PCRs described in the protocols hosted on the WHO website at the time which were these: - China CDC protocol: uses ORF1ab and N genes as target. - Protocol of the Pasteur Institute (France): uses two fragments of the RdRP (which is supposed to be SARS.CoV-2 specific). - United States CDC protocol: uses three fragments of the N gene. - Protocol of the National Institute of Infectious Diseases of Japan: it is the only one that has as target the S gene together with other genes supposedly shared with other coronaviruses. - Charite Protocol (Germany): uses the E, N and RdRP genes. - Hong Kong University Protocol: uses ORF1b-nsp14 and N gene. - National Institute of Health Thailand protocol: uses the N gene. We then introduced the sequence of the primers - the one that indicates the beginning of the sequence to be detected (forward) and the one that indicates the final (reverse) - into the BLAST so that it could search for them in two databases: a collection of microbe genomes and the one corresponding to the human genome. THE SEQUENCES OF THE SO-CALLED SARS-COV-2 ARE FOUND BOTH IN HUMANS AND IN NUMEROUS MICROBES! Let's see in detail the procedure taking as an example the initiators of the French protocol. Once on the BLAST website, we chose Microbes to search the microbial genome databases and moved to the next page. Then a form appeared in which we entered the sequence of the forward initiator of the French protocol -that is ATGAGCTTAGTCCTGTG-, we selected the option Highly similar sequences and pressed the BLAST key. Just a few seconds later the results appeared -we took a screenshot (image 1)- and we were shown 100 sequences of microbes -particularly bacteria and archaea- with a coincidence of between 77% and 100% with an identity percentage of 100%. We then returned to the home page and that second time we chose Human to search the human genome, we repeated the same operation and after a few seconds the result appeared which we screen captured again (image 2). And it turns out that the sequence entered coincides with 74 sequences of the human genome, with a coincidence of between 66% and 100% and a percentage of identity of 100%. And that indicates that the sequence of that initial PCR primer that is supposed to be specific to SARS-CoV-2 actually corresponds to 74 fragments of the human genome and a hundred microbial fragments as well! We then decided to repeat the operation but with the final or reverse primer - which is CTCCCTTTGTGTGTGT - and the results were similar. Since these were very short sequences -about twenty genetic letters or nucleotides- we decided to try again but with the target sequence defined by these two primers, i.e. the sequence of the supposed SARS-CoV-2 genome that is between the initial primer and the final primer. Obviously, for this we needed the sequence that is officially claimed to be the "SARS-CoV-2 genome" and although thousands of laboratories claim to have isolated and sequenced it -a false claim as we have explained in previous reports- we decided to go to the National Centre for Biotechnology Information website: https://www.ncbi.nlm.nih.gov/nuccore/NC_045512.2? report=genbank&to=29903. Once there, we located the "target sequence", a fragment of 108 nucleotides located between positions 12,690 and 12,797 of the "genome", which is this one: ATGAGCTTAGTCCTGTTGCACTACGACAGATGTTGTGCCGGTACACAAACTGCTTGCACTGAT GACAATGCGTTAGCTTACAACAACAAAGGGAG. With this we repeated the steps previously described and the results were again surprising since there appeared again a hundred microbe sequences with a percentage of a match of 100% and four sequences of the human genome with an identity percentage between 83% and 95%. The matches were therefore lower but the important thing is that we continue to find fragments of the supposed "target sequence" of SARS-CoV-2 both in microbes and in our own genome. Truly astonished we took a further step and tested with the gene considered at that time as the most specific of SARS-CoV-2, the E gene that is supposed to generate the envelope proteins and is located between positions 26,245 and 26,472: ATGTACTCATTCGTTTCGGAAGAGACAGGTACTACGTTAATAGTTAATAGCGTACTTCTCTTGCT TTCGTGGTATTCTTGCTAGTTACACTAGCCATCCTGCTTCGATTGTGCGTACTGCTGCAATATTG TTAACGTGAGTCTTGTAAAACCTTTACGTTTACTCGTGTTAAAATCTGAATTCTTCTAGAGTTCG ATTCTGGTCTAA. We repeated with it the steps already described and the result was even more surprising because despite its length another hundred microbe sequences appeared with a percentage of identity of 100% and 10 sequences of the human genome with a percentage of identity between 80% and 100%. And similar results were obtained with a fragment chosen at random and with the N gene which they say corresponds to the proteins of the SARS-CoV-2 nucleocapsid. We finally decided to test with the S gene which is said to generate the structural "spike" proteins that are key to entry into the cell and was subsequently considered to be the most specific SARS- CoV-2 gene. Since it is a gene whose sequence is much longer - 3821 nucleotides between positions 21,563 and 25,384 - we tested with two fragments chosen at random within that gene and the first - TTGGCAAAATTCAAGACTCACTTTC - resulted in another hundred microbe sequences and 93 sequences of the human genome and the second - CTTGCTGCTACTAAATGCAGAGTGT - a hundred microbial sequences and 90 of the human genome. Finally we decided to test with the initiators of the Japan Protocol, the only one that includes target sequences of the S gene and, the reader will have already guessed, the results were onceagain similar: a hundred microbe sequences and 93 sequences of the human genome with an identity percentage between 94.12% and 100%! CONCLUSIONS The consequence of all that we have just explained is clear and immediate: THERE IS NO VALID TEST TO DETECT SARS-COV-2, neither antibody or antigen tests nor RT-PCR. And we included those based on the supposed gene that codes for the S1 or spike protein. And that means that ALL THE NUMBERS OF "CASES", "INFECTED", “SICK", "Asymptomatic" OR "DEAD DUE TO COVID-19" LACK A SCIENTIFIC BASE AND ALL “POSITIVES” ARE FALSE POSITIVES, something that should be communicated immediately to those affected and those responsible should be held accountable. We end by adding that even the WHO itself does not really believe in these tests. Just read the document published last September 11 as a laboratory guide for SARS-CoV-2 entitled Diagnostic tests for SARS-CoV-2 - it is available at https://apps.who.int/iris/rest/bitstreams/1302661/ retrieve - and it literally says on page 5: "Whenever possible, suspected active infection should be tested with a nucleic acid amplification test (NAAT) such as RT-PCR. NAAT tests should target the SARS-CoV-2 genome but since there is no known global circulation of SARS-CoV-1 a Sarbecovirus sequence (presumed to include at least five human and animal coronaviruses including SARS-CoV-1 and SARS-Cov-2) is also a reasonable target". That is, WHO agrees to use non-specific sequences to detect SARS-CoV-2. That is not all because the manual later states, "An optimal diagnosis consists of a NAAT test with at least two genome-independent targets of the SARS-CoV-2; however, in areas where transmission is widespread, a simple single-target algorithm can be used.” The WHO manual states, "One or more negative results do not necessarily rule out SARS- CoV-2 infection. There are a number of factors that can produce a negative result in an infected individual including poor quality of the sample, late collection of the sample, inadequate handling, or technical reasons inherent in the test, such as mutation of the virus or inhibition of PCR.” What are the judges waiting for to act on their own initiative? Jesus Garcia Blanca Note: the author publicly thanks Juan Pedro Aparicio Alcaraz for his patient and meticulous collaborative work in the search for scientific articles and for his tedious work with the BLAST. THIS REPORT APPEARS IN (https://www.dsalud.com/revistas/numero-242-noviembre-2020/) Quote Link to comment Share on other sites More sharing options...
Macnamara Posted December 17, 2020 Share Posted December 17, 2020 (edited) https://telegra.ph/Alle-führenden-Wwissenschaftler-beesten-COVID-19-existiert- nicht-07-03 Leading corona researchers admit that they have no scientific evidence for the existence of a virus Corona_Facts July 03, 2020 Download this article as a PDF (PDF will not be updated) My first words in the article are "buckle up, the shock will be intense". What you will learn in this article is beyond your horizon. The latest information has the explosive power to uncover the greatest deceit against humanity. According to this information, every citizen should support the people who fought for this important information. It's finally out, all leading scientists on COVID-19 (SARS-CoV-2) have admitted that the scientific rules to detect COVID-19 have not been established. But everything in its right place. I will explain to you what this means. Please read this article to the end. Spread this article. The planemic | ( Telegram Post ) should end with these statements with immediate effect, even more so, the entirety of virology must be called into question!The detection method of the PCR tests is completely meaningless I have already discussed the subject of PCR testing in two of my articles [ The PCR test is not validated ] | [ PCR: A DNA test is treated as a manipulation instrument ]. There I prove without a doubt that the PCR test, which is considered the “gold standard” for COVID tests, is completely “meaningless”. The question now is: what is required first for the isolation / detection of viruses? We need to know where the RNA for which the PCR tests are calibrated comes from. From textbooks (e.g., White / Fenner. Medical Virology, 1986, p. 9), as well as leading virus researchers such as Luc Montagnier or Dominic Dwyer, state that particle purification - that is, the separation of an object from everything that is not that object, such as e.g. Nobel laureate Marie Curie, who in 1898 purified 100 mg of radium chloride by extracting it from tons of pitchblende – is an essential prerequisite for verifying the existence of a virus and thus proving that the RNA of the particle in question originates from a new virus. The reason for this is that PCR is extremely sensitive, meaning that it can detect even the smallest pieces of DNA or RNA - but it cannot determine where these particles came from. That has to be determined beforehand. And because the PCR tests are calibrated on gene sequences (in this case RNA sequences, because SARS-CoV-2 is presumablyan RNA virus), we have to know that these gene snippets are part of the virus we are looking for. And to know that, it is necessary to properly isolate and purify the suspected virus. Koch's postulates are the decisive criteria for scientifically detecting a virus Before the invention of the electron microscope in the 1930s, it was not possible to see particles this small. Using the electron microscope, the new generation of virologists began examining unclean materials and claiming they could detect the viruses. The problem is that just by looking at a particle one cannot tell what it is or what it does without fulfilling Koch's postulates. Koch's postulates were drawn up by the great German bacteriologist Robert Koch in the 19th century. Definition: Four requirements made by Robert Koch that have to be met in order for a Microorganism may be called the causative agent of a specific disease. 1. Koch's postulate • It must be possible to detect the microorganism in all cases of illness with the same symptoms, but not in healthy individuals. 2. Koch's postulate • The microorganism can be transferred from the sick individual into a pure culture (isolation) 3. Koch's postulate • After infection with the microorganism from the pure culture, a previously healthy individual shows the same symptoms as that from which the microorganism originally originated. 4. Koch's postulate • The microorganism can be converted back into a pure culture from the infected and diseased individuals. The leading scientists admit that none of them have isolated a virus! Torsten Engelbrecht ( award-winning journalist) and Konstantin Demeter (independent researcher) asked the scientific teams engaged in the relevant work to which reference is made in connection with SARS-CoV-2 toprove whether the electron microscopic images depicted in their in vitro experiments purified viruses. But not a single team could answer "yes" to this question - and no one said purification was not a necessary step. We only received answers such as "No, we did not receive an electron micrograph showing the degree of purification" (see below). We asked several study authors, " Do your electron micrographs show the purified virus (an isolate)?" , and they gave the following answers: Study 1: Leo LM Poon; Malik Peiris. “Emergence of a novel human coronavirus threatening human health” Nature Medicine , March 2020 [ Nature ] Answering Author: Malik Peiris Date: May 12, 2020 Answer: “The image is the virus budding from an infected cell. It is not purified virus. " Study 2: Myung-Guk Han et al. "Identification of Coronavirus Isolated from a Patient in Korea with COVID-19", Osong Public Health and Research Perspectives , February 2020 [ Pubmed ncbi ] Answering Author: Myung-Guk Han Date: May 6, 2020 Answer: "We could not estimate the degree of purification because we do not purify and concentrate the virus cultured in cells." Study 3: Wan Beom Park et al. “Virus Isolation from the First Patient with SARS-CoV-2 in Korea”, Journal of Korean Medical Science , February 24, 2020 [ Pubmed ncbi ] Answer Author: Wan Beom Park Date: March 19, 2020 Answer: "We did not obtain an electron micrograph showing the degree of purification."Study 4: Na Zhu et al., “A Novel Coronavirus from Patients with Pneumonia in China”, 2019, New England Journal of Medicine , February 20, 2020 [ nejm ] Answering Author: Wenjie Tan Date: March 18, 2020 Answer: "[We show] an image of sedimented virus particles, not purified ones." Note: There was no need to inquire about this publication, the authors openly admit "our study does not fulfill Koch's postulates" Source: COVID19 PCR Tests are Scientifically Meaningless With regard to the work mentioned, it is clear that what is shown in the electron micrographs (EMs) is the end result of the experiment, i.e. there is no other result from which they could have made EMs. That is, if the authors of these studies admit that their published EMs do not show purified particles, then they definitely do not have purified particles that can be claimed to be viral. (It should be noted in this context that some researchers use the term "isolation" in their work , but the procedures described therein do not constitute a proper isolation (purification) process. Consequently, the term "isolation" is misused in this context ). For example, the authors of four of the most important papers published in early 2020 claiming the discovery of a new coronavirus admit that they had no evidence that the origin of the virus genome were virus-like particles, or cell debris, pure or impure, or particles of any kind. In other words, the existence of SARS- CoV-2 RNA is based on belief, not fact. Torsten Engelbrecht ( award-winning journalist) and Konstantin Demeter (independent researcher) have appointed Dr. Contacted Charles Calisher who is an experienced virologist. In 2001, Science published a "passionate plea ... to the younger generation" by several veteran virologists, including Dr. Charles Calisher [modern virus detection methods like] the smooth polymerase chain reaction [...] say little or nothing about how a virusreproduces, which animals are its hosts, [or] how it makes people sick. It's like trying to tell if someone has bad breath by looking at his fingerprint "[1]. And that's why the two asked Dr. Calisher whether he knows of a single paper in which SARS-CoV-2 was isolated and finally really purified. His answer: "I know of no such publication. I have kept an eye out for one." [2] What does that mean? In short: NOT A SINGLE KOCH'S POSTULATE WAS OBSERVED! In other words: That actually means that one cannot conclude that the RNA gene sequences that the scientists took from the tissue samples prepared in the aforementioned in vitro tests and for those that the PCR tests are ultimately "calibrated" for, belong to a certain virus - in this case SARS-CoV-2. In addition, there is no scientific evidence that these RNA sequences are the causative agent of what is known as COVID- 19. In order to establish a causal connection in one way or another, that is, beyond virus isolation and purification, it would have been absolutely necessary to conduct an experiment which fulfills Koch's four postulates. But there is no such experiment, as Amory Devereux and Rosemary Frei recently demonstrated for OffGuardian. The need to fulfill these postulates with regard to SARS-CoV-2 is evident not least from the fact that attempts have been made to fulfill them. But even researchers who claimed to have done so were in fact unsuccessful . Sources: [1] Martin Enserink. Virology. Old guard urges virologists to go back to basics, Science, July 6, 2001, p. 24 Addition: Science [2] E-mail from Charles Calisher from May 10, 2020 These can be requested from Torsten Engelbrecht and Konstantin Demeter . [3] Main source: COVID19 PCR Tests are Scientifically MeaninglessThe publication in Nature "The pathogenicity of SARS- CoV-2 in hACE2 transgenic mice" also does not meet any of Koch's postulates An example of this is a study published in Nature on May 7th. This study, among other procedures that invalidate the study, did not meet any of the postulates. The allegedly "infected" laboratory mice did not show any relevant clinical symptoms that could clearly be traced back to pneumonia, which according to the third postulate should actually occur if a dangerous and potentially fatal virus were actually at work there. And the light bristles and weight loss temporarily observed in the animals are negligible, not only because they might have been caused by the procedure itself, but also because the weight returned to normal. Also, no animal died except those they killed to perform the autopsies. And let's not forget: these experiments should have been done before developing a test, which is not the case. None of the leading German proponents of the official theory on SARS-Cov-2 / COVID-19 was able to answer the question of how they can be sure, without having a purified virus, that the RNA gene sequences of these particles belong to a certain new virus ? Torsten Engelbrecht ( award-winning journalist) and Konstantin Demeter (independent researcher) are the leading German representatives of the official theory on SARS-Cov-2 / COVID-19 - the Robert Koch Institute (RKI), Alexander S. Kekulé (University of Halle), Hartmut Hengel and Ralf Bartenschlager (German Society for Virology), the aforementioned Thomas Löscher, Ulrich Dirnagl (Charité Berlin) or Georg Bornkamm (virologist and professor emeritus at the Helmholtz Center Munich) asked the following question: "If the particles that are supposed to be SARS-CoV-2 have not been purified, then how do you know that the RNA gene sequences on those particles belong to a particular new virus? Especially when there are studies that show that substances such as antibiotics that are added to test tubes in the in vitrovirus detection experiments can "stress" the cell culture to such an extent that new gene sequences are formed that were previously undetectable - an aspect that Nobel laureate Barbara McClintock pointed out in her 1983 Nobel lecture. " It should not go unmentioned that we finally have the Charité - the employer of Christian Drosten, Germany's most influential virologist with regard to COVID-19, advisor to the German government and co-developer of the PCR test, which was the first to be "accepted" by the WHO worldwide ( not validated! ) - for answering questions on this topic. But we didn't get replies until June 18, 2020 , after months of non-response. In the end we only made it with the help of the Berlin lawyer Viviane Fischer. Regarding our question: " Has the Charité made sure that the appropriate particle purification has been carried out", the Charité admits that it did not use any purified particles. And although they claim that "the Charité virologists are certain that they are testing for the virus", they state in their work ( Corman et al. ): "RNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany) " That is, they simply assumed that the RNA was viral. Incidentally, the paper published on January 23, 2020 by Corman et al. did not even follow a proper peer review process, and the procedures outlined in it were not accompanied by controls - although these two things make scientific work really robust. But it is much worse, the Charité test was made before the first publication by the Chinese. So there was no clinical data available to even develop a test. Drosten even admits it! Please read my article: " The science fraud by Prof. Christian Drosten " or the complete article in the Wissenschaftsplus magazine by Dr. Stefan Lanka . Also read breaking news in the newsletter of Dr. Stefan Lanka from June 13th, there you will learn, among other things, that Dr. Stefan Lanka has accused Prof. Drosten of crimes against humanity!Dr. Stefan Lanka has shown in an incredibly good analysis that Covid-19 was never detected. Excerpt from Wissenschaftsplus Magazin 1st edition 2020: Now follows an excerpt from the magazine which Dr. Stefan Lanka (molecular biologist and virologist) wrote in connection with the misconception about SARS-CoV-2. It is worth buying the complete edition! "Individual components are removed from the components of the dead tissue and cells, misinterpreted as components of a virus and mentally assembled into a viral model. A real and complete virus does not appear in the entire "scientific" literature. The consensus-building process in which the participants argued, what belongs to the virus and what doesn't, took decades with the measles virus. With the supposedly new China Coronavirus 2019 (2019-nCoV, now renamed), this consensus-building process only took a few clicks of the mouse. With a few clicks of the mouse, a program consisting of the molecular sequence of short pieces of nucleic acids of the dead tissues and cells, the composition of which was determined biochemically, turned into the much longer, now supposedly complete and supposed genetic material, of a certain old or novel one. Depending on the specifications, a Virus was constructed. In reality, not even these manipulations, called "alignment" (an alignment procedure), can produce “complete” genetic material of a virus known as its genome. During the cognitive assembly process of the “viral genetic strand”, unsuitable sequences are “smoothed out” and missing ones are added. In this way a “genetic sequence” is invented that does not exist, that has neither been discovered nor in its entirity proven. To summarise: from short fragments, and based on a model of a viral genetic strand, a larger piece is mentally constructed, which actually does not exist. For example, missing from the purely "cognitive" construction of the measles viral genetic strand in the case of the actually extant, short fragments of the cell's own molecules, are far more than half of the molecular sequences that are supposed to be represent in a whole virus. These are partly artificially generated, biochemically and the rest are simply invented." Anyone who speaks English can directly recognize the fact that the “virus genome strand” (Complete genome) is only constructed in thought in this publication, in which the RKI was significantly involved: “CompleteGenome Sequence of a Wild-Type Measles Virus Isolated during the Spring 2013 Epidemic in Germany", to be found at: RKI Prof. Mankertz, co-author of this publication and head of the National Reference Institute for Measles, Mumps and Rubella at the Robert Koch Institute (RKI), in response to inquiries, claimed that control experiments were carried out for this study, which rule out that typical cell-specific components are misinterpreted as virus components. However, they refused to hand over the documentation of these control experiments. In the complaint process, Prof. Mankertz replied that she did not have any control attempts and that her Munich colleagues have certainly carried out and documented these control attempts. Dr. Stefan Lanka wrote to all authors and their laboratory managers and asked about the control experiments, which have been mandatory since 1998. None of those who were written to answered. The rectors of the institutes contacted also did not respond, and so the complaint procedure came to nothing. Dr. Stefan Lanka analyzed the first two authoritative publications by the CCDC on Covid-19 In the first authoritative publication by the authors of the CCDC ( A Novel Coronavirus from Patients with Pneumonia in China, 2019 ) on the results of their research, "A new coronavirus con patients with pneumonia in China, 2019", there is no accumulation of cases with atypical pneumonia ("patient with pneumonia of unknown cause") reported. They report that the patients found can be combined into a "cluster", a group with common characteristics. The common characteristic was the more or less frequent visits to a seafood wholesale market in Wuhan. How small the group of patients with atypical pneumonia actually was can be seen from the fact that the CCDC took swabs and fluids from the lower respiratory tract from only four patients in order to search for known and unknown pathogens. In this study, which is considered authoritative, it says under Discussion: "our study does not fulfill Koch's postulates"This clearly proves that this study can at no time be evidence of a novel virus! Source: Dr. Stefan Lanka - Science plus – misinterpretation - virus - part 2 In the examinations of the five people, which are documented in the two publications relevant to the corona crisis [1] [2], no research was carried out into the possible presence or history, signs, mechanisms and effects, of these known causes of atypical pneumonia. Virologists usually do not do that anyway and the members of the CCDC were not also due to the panic of the prevailing circumstances. Excluding the mention of atypical pneumonia proves serious medical malpractice and prevents patients from being treated correctly. Those affected run the risk of being treated incorrectly with a cocktail of antibiotic substances rich in side effects, which are capable of causing the death of patients on its own, especially in the case of an overdose. This is what happened and was documented in the Lancet . The virologists of the CCDC state in both publications that there is still no evidence from these sequence proposals that they can actually cause diseases. On January 10th and January 12th, 2020 the Chinese sequence proposals were still preliminary and had not yet been subjected to the strict process of scientifically prescribed verification. [1] A Novel Coronavirus from Patients with Pneumonia in China, 2019 [2] A new coronavirus associated with human respiratory disease in China Further source: Dr. Stefan Lanka - Science plus - misinterpretation - virus - part - 2 Other authors were honest enough to admit that they failed to attain Koch's postulates In the publication of January 24th, 2020 Huang C et al. clinical features of patients infected with 2019 novel coronavirus in Wuhan, China. Lancet, the authors openly admit: “we did not perform tests for detecting infectious virus in blood”. (This also by no means fulfills Koch's postulates)For a comprehensive analysis of the publications and further studies on Coivid-19, I strongly recommend the gigantic summary by David Crowe - Flaws in Coronavirus Pandemic Theory . This work is continuously updated with the latest findings. It offers one of the most comprehensive analyzes up to this point. Matthew B. Frieman, PhD Associate Professor of Microbiology and Immunology and Virologist at the University of Maryland School of Medicine, was skeptical! he said: " I am stunned by the timeline and speed of this isolation and characterization, if it's all true," Dr. Andrew Kaufman also analyzed the studies on SARS Andrew Kaufman MD References: - Bachelors of Science in Biology MIT - Doctor of Medicine, Medical University of South Carolina -Psychiatry Residency, Duke University - Former Medical Lecturer in Hematology and Oncology, South Carolina Medical University - Former Assistant Professor of Psychiatry, SUNY Upstate Medical University - Licensed and board certified in psychiatry and forensic psychiatry Kaufman not only dealt with the publications of the new coronavirus SARS-CoV-2, but also with its predecessor from 2003 (SARS-CoV-1). He realized that not only SARS-CoV-2 has not been scientifically proven, but also noted that the same mistakes had also been made with the alleged SARS-CoV-1 virus. To come to the point: The following applies to all publications: -> Koch's postulates were not adhered to! -> The postulates according to River were not complied with (modified postulates) Ergo: not a single scientific proof of a pathogenic virus.Those who prefer to watch a video to get all the details (I will only list some information in writing) should do so in one of the two videos below. The video by Andrew Kaufmann ( German ) | ( English ) Backups are available. SARS 2003 In the publication in NATURE - Koch's postulates fulfilled for SARS virus, the heading suggests, as so often, that Koch's postulates have been fulfilled. 5 relevant studies are listed there. However, under MAIN it says " According to Koch's postulates, as modified by Rivers for viral diseases, six criteria are required to establish a virus as the cause of a disease" Here it becomes clear that it is not about Koch's postulates, but modified postulates. In the video by Dr. Andrew Kaufmann, Koch's postulates are compared with those of RIVER, so that you can understand the differences. River’s postulates do not consist of 4 (Koch's postulates), but of 6.1. Rivers, TMJ Bacteriol. 33, 1-12 (1937) . • Genetic material (DNA, RNA) is not mentioned in any criterion • ... now it is possible to bring excellent evidence that an organism is the cause of a malady without the complete satisfaction of the [Koch’s] postulates. (Page 3) • ... particularly those [diseases] caused by viruses, the blind adherence to Koch's postulates may act as a hindrance instead of an aid. (Page 4) • ... It is obvious that Koch's postulates have not been satisfied in viral diseases. (Page 6) • ... In the first place, it is not obligatory to demonstrate the presence of a virus in every case of the disease produced by it. (Page 6) • ... Viruses, regardless of whether they are parasites or the fabrications of autocatalytic processes, are intimately associated with host cells (page 6) • ... "by means of inoculation of material ... obtained from patients with the natural disease" (page 11) • ... If the inoculated animals become sick or die in a characteristic manner, and, if the disease in them can be transmitted from animal to animal by means of inoculations with blood or emulsions of involved tissues free from ordinary microbes or rickettsiae, one is fairly confident that the malady in the experimental animals is induced by a virus (Page 7) So in summary he says, if you apply his criteria and adhere to all of them, it is not certain, but you can be fairly confident that a virus caused this disease. In other words, even if all 6 criteria have been applied it will only make you feel pretty confident, inconclusive, not sure, not 100%, just pretty confident. The Nature article claims that the first 3 criteria (River) have been met for the subsequent publications.The first three criteria - isolation of virus from diseased hosts, cultivation in host cells, and proof of filterability - have been met for SCV by several groups 2 , 3 , 4 , 5 . Now I will briefly summarize what Dr. Kaufman has analyzed, please remember that this is only brief information and you should really watch the video (see above). First of all, I would like to say that none of the following studies (not even those by Prof. Drosten) adhere to any of River’s postulates. 2. Poutanen, SM et al. N. Engl. J. Med. (In the press) . • No positive isolation of a virus (an attempt was actually made to isolate, but this was negative). • They did not cultivate in host cells (they took Vero cells from monkeys) These produce in connection with antibiotics (exosomes = the body's own RNA!). • Proved no filterability. Instead, they used various screening tests for the presence of bacteria and other viruses. 3. Drosten, C. et al. N. Engl. J. Med. (in the press). • No isolation of a virus, interestingly you found particles that looked like another virus (paramyxovirus) in one sample but not in other samples. • They have not grown in host cells (they took Vero cells from monkeys). • No filterability proven. So the work of Prof. Christian Drosten also does not even adhere to River's modified, lighter postulates. 4. Ksiazek, TG et al. N. Engl. J. Med. (in the press). • No isolation of a virus (once again, as in Drosten's work, only genetic material obtained). • They have not grown in host cells (they took different cells from Vero E6, NCIH292, MDCK, LLC-MK2 and B95-8 cells).• Proved no filterability. Instead, they used various screening tests for the presence of bacteria and other viruses. 5. Peiris, JSM, et al. Lancet 361: 1319-1325 (2003). • No isolation of a virus (again as in Drosten's work, only acquired genetic material was used) • They did not cultivate in host cells (they took fetal resus monkey cells) • Did not prove filterability, they used various screening tests for the presence of bacteria and other viruses instead In summary (SARS 2003): In none of these studies were even the first 3 criteria met and thus cannot be claimed as evidence of a pathogenic virus. SARS-CoV-2 (2019) So let's take River's criteria for Covid-19 and check whether these were met in the publications. First of all: none of the following studies 1. met the first 3 criterion. 2. tried to adhere to the 4th and 5th criteria Because no attempt was even made to comply with the 4th and 5th criteria, one can draw the conclusion from this alone that one cannot say that this could be a new pathogen. First of all: none of the following studies 1. met the first 3 criterion. 2. tried to tackle the 4th and 5th criteria at all Because no attempt was even made to adhere to the 4th and 5th criteria, one can draw the conclusion from this alone that one cannot say that any thing could be a cause 1. Peng Zhou - Discovery of a novel coronavirus associated with the recent pneumonia outbreak in humans and its potential bat origin• No isolation of a virus (only obtained genetic material). • They did not grow in host cells (they took Vero cells and Huh7 cells, they only did this in 1/7 of the patients). • Proved no filterability You admitted in your study that this study can not provide evidence for proof, but that many more clinical trials are needed to be able to make a statement. Using a PCR sequence test, they assumed that what was found was similar to the 2003 coronavirus, as the test showed a match of 80%. A human's DNA is 96% identical to that of a chimpanzee ... 2. Na Zhu - A Novel Coronavirus From Patients With Pneumonia in China, 2019 (2020 Feb 20; 382 (8): 727- 733) • No isolation of a virus (only obtained genetic material). • They did not grow in host cells (they took lung cancer cells). • Did not prove filterability (they used centrifugation). You admit in your publication under Discussion: "our study does not fulfill Koch’s "our study does not meet Koch's postulates" 3. Jeong-Min Kim - Identification of Coronavirus Isolated from a Patient in Korea with COVID-19 () 2020 Feb; 11 (1): 3-7 • No isolation of a virus (only obtained genetic material). • They have not grown in host cells (they took Vero cells and also used antibiotics) • proved no filterability 4. McMaster University Canada Very little information is available on this study. Because only a fraction has been published. • No isolation of a virus (only obtained genetic material).• They did not grow in host cells (they took a different type of mammalian cell). Summarized: Dr. Andrew Kaufmann comes to the same conclusion as everyone else that there is no scientific evidence of a pathogenic virus. (SARS-CoV-1 and 2) Despite the claim in ( NATURE ) of fulfilling Koch's postulates, in none of the publications on SARS-CoV-1/2 were the Koch's or River postulates fulfilled (0/6 criteria). Only one of the criteria for 2019 was met. The 6th criterion, the least important of all criteria. Rumors and lies created a pandemic even though there was no evidence! Please have a look at the video of Dr. Andrew Kaufman! The Rotterdam Monkey Experiment (SARS) Issue 32, May 2020 ExpressZeitung (pp. 66 - 69)Conclusion to the article My appeal to you is as follows, the burden of proof is so devastating as to put an end to the plandemic from one day to the next. Please support everyone who can get us out of this misery. Simply speaking and giving people courage also helps. Follow us on Telegram for more summaries and important news. Main channel: https://t.me/Corona_Fakten Donate : paypal.me/CoronaFakten You can send questions by e-mail: [email protected] Channel for discussion: " Corona_Fakten_Diskussion " Post: https://t.me/Corona_Fakten/15 6 Link for Facebook, Twitter and Co.: https://telegra.ph/Alle-führenden- Wwissenschaftler-best%C3%A4tigen-COVID-19- existiert-nicht-07-03 Also read our other important posts 1. The spell of the mask fraud is broken 2. The PCR test is not validated 3. PCR: A DNA test becomes a manipulation tool 4. The fraud at the meat manufacturer Tönnies has been exposed 5. Sweden's facts refute belief in Corona 6. Court records confirm: No scientific evidence for the existence of the measles virus 7. The scientific fraud by Prof. Christian Drosten 8. The misinterpretation of antibodies 9. Crazy, crazier, antibody tests 10. Supplementary analysis for the 4th meeting of the Corona Committee 11. Vaccines that can destroy our genetic makeup Edited December 17, 2020 by Macnamara Quote Link to comment Share on other sites More sharing options...
Macnamara Posted December 17, 2020 Share Posted December 17, 2020 Here are Kaufman’s words verbatim: “The PCR test … doesn’t for a virus at all. What that tests for is a sequence of RNA, which is genetic material. And the way they obtain that, is also they take the impure sample, basically like the lung fluid in this case from some people who are sick, or possibly a throat swab, and they amplify short little sequences, and sequences that they are specifically looking for mostly because they have this library of gene sequences of viruses. But the thing is if you go back, they’ve always characterized them this way. So they’ve never once had an intact virus particle, and then sliced it open, and taken the RNA out, and done a sequence from end to end. That’s never been done. What they do instead is they take this impure sample, and they look for specific sequences that they’ve pre-identified as being viral in nature, from this database. And then what they’re doing is amplifying these short little sequences, maybe 150-250 base pairs, and they’re splicing them together into this one long strand of 30,000, which they say is the viral genome, but it’s actually just this Frankenstein type of assembly of all these little pieces, that we don’t even have any proof [are] related. They could even come from different types of cells or different creatures. And when there’s gaps, they’re basically using sequences that they get from that database of other viruses that are also put together in this Frankenstein-type way, and they sew all those together and say that this is the genome sequence of this virus. And that’s the procedure. They’re testing for something from that but we don’t really know what it is, except it’s most likely our own sequences. So that’s why there’s so many positive results, because they are essentially testing our own genetic sequences.” Quote Link to comment Share on other sites More sharing options...
Mr H Posted December 17, 2020 Share Posted December 17, 2020 4 hours ago, Macnamara said: sorry to hear about your dad, i had a relative in hospital with thickening blood so i'm looking for a factor too one of the most compelling leads i have found is that the flu vaccine can make peoples immune systems turn on themselves through viral interference do you know if your dad had a flu jab at any point? Thank you. Yes he did have the flu vaccine every year since he turned 70. I do agree that these vaccines can cause all sorts of diseases, does seem strange that this has happened in 2020 only and not prior years. Perhaps last winter they put something different in there? Quote Link to comment Share on other sites More sharing options...
Macnamara Posted December 17, 2020 Share Posted December 17, 2020 10 hours ago, Mr H said: Yes he did have the flu vaccine every year since he turned 70. interesting. I believe my family member had the flu vaccine also Quote Link to comment Share on other sites More sharing options...
beyefh Posted December 17, 2020 Share Posted December 17, 2020 The answer is -- yes, no. No to what we see happening today, and yes that Gates has funded labs to create and release mosquitoes infested with Bird Flu and Swine Flu. What we are seeing now that seems to have been ignored is -- nano dust, fine dust particles nobody seems to know who, what, when, where or how that stuff is being blown across the world. It is so fine it does get in your lungs and people are also complaining of itchy skin, itchy scalp, rashes, problems breathing and flaky scalp. Have you noticed the fine dust covering stuff in your home? When you wake up in the morning, is there "stuff" on your face, a fine gritty something? Is this the origin of so called "covid" which they refuse to identify, and source of our coughs and sneezing and other symptoms pasted onto the "covid" claims? It appears Billy Gates won't ignore a chance like that to make a buck off a "vaccine", which of course won't work on dust, so he adds HIV/AIDS and heaven only knows what else. But yes, he is certainly adding Bird Flu and Swine Flu to his heinous agenda. Thank God for Mr. Icke. Our hope in the time of darkness. Quote Link to comment Share on other sites More sharing options...
Mr H Posted December 18, 2020 Share Posted December 18, 2020 I was trying to think of further supportable evidence for either side of the argument and this point came to mind. The fact that no virus control strategy has worked in preventing deaths (as measured by them), or the spreading of the virus (as measured by them) should lead to the question, is the virus the cause of these deaths? It's something I would question or ponder if I was a scientist. Quote Link to comment Share on other sites More sharing options...
rideforever Posted December 18, 2020 Share Posted December 18, 2020 45 minutes ago, Mr H said: I was trying to think of further supportable evidence for either side of the argument and this point came to mind. The fact that no virus control strategy has worked in preventing deaths (as measured by them), or the spreading of the virus (as measured by them) should lead to the question, is the virus the cause of these deaths? It's something I would question or ponder if I was a scientist. The Postulates are not a small thing, they are the basis of pathogen medicine. How do you know what is causing disease? How can you pinpoint the origin? The answer is the postulates, which specify the isolation of the pathogen and then recreating the disease in a new animal. Some scientists now say that viruses cannot be located by the Postulates, others still hold to the Postulates. But if you will remember the Sub Prime Mortgage Crisis 2008 ... this was caused by the creation of new types of stocks called CDOs (Collateralized debt obligation) and CDSs (Credit default swaps). What the fuck are they? Well exactly. It's too complicated to understand for normal people. And so Wall street made trillions of dollars out of it whilst nobody really understood what is going on. Afterwards the country was ruined as what essentially happened is money was sucked out of America and put into the pockets of a few Wall street bankers. Literally like that. Now everyone else pays. So it's the same with "viruses" and the PCR Test ... both of which are just over the edge of the horizon. And if people could understand what it's about - it would come to a rapid end. Few people even on this board have the stamina and intelligence to find the answers ... they are well hidden. The Big Pharma industry, just like Wall street, invest a lot of time in burying inconvenient things. Journalists and Scientists, if they want to eat dinner cannot push the boat ... and cannot tell the truth. In Spring I listened in on a number of message forums for scientists and doctors ... who were discussing Koch's Postulates. Almost all of them had never heard of them. Just think what that means, it means they are not taught to independently verify things for themselves. They are in the machine, they are sheep, trained sheep. Quote Link to comment Share on other sites More sharing options...
Mr H Posted December 18, 2020 Share Posted December 18, 2020 Yes. What I’m trying to understand is whether the context has changed since the postulates were discovered and whether they are relevant today. I’m coming from a 0 knowledge base so I don’t know the answer. This was one particular article that got me thinking about it. Not saying this article is correct, especially given the source, but it threw in some things that got me to question the postulates. I’m still trying to work my way through this article to see if it holds up in any way shape or form. Will post it here for others to read. Full article Sigh, yes, the 'COVID virus' is real - Virology Down Under Extract Postulating into failure Koch’s postulates – derived from his work on bacteria – were formally proposed at a lecture by Koch in 1890. From Causation and Disease: The Henle-Koch Postulates Revisited, by Alfred Evans.[5] Remember – these were made before anything was really known about what a virus truly was. They were designed with bacteria in mind, ad as a guide not a dictum. For context, that’s before we had ever visualised a human or plant virus, before organ or cell culture of viruses, before sequencing of viral genes or genomes and before we had labelled antibodies we could as probing tools to show viral proteins in tissues. It was known that this toxic stuff (virus, from Latin, translates to ‘slimy liquid, poison’) was smaller than bacteria because it passed through filters that stopped them, and yet could still cause disease. Discovery of human viruses came later still (Yellow fever virus, 1901-1921). Koch’s postulates were never intended to be rigidly applied, even then. In fact, trying to strictly adhere to them probably delayed the discovery of viruses.[11] Quote Link to comment Share on other sites More sharing options...
rideforever Posted December 18, 2020 Share Posted December 18, 2020 @Mr H Ultimately you will personally get screwed unless you personally become intelligent. Right now all you can do is play one person off another one because you don't really understand any of the above detailed bullshit. I can point out various bullshits about the above but it doesn't mean anything to you - after all why would you trust me. At least those people are "scientists", right ? It's interesting we are discussing whether one particular virus exists or not ... whilst all day long viruses of all sorts are sweeping through the world. Like the many flus sweeping through the UK right now, and mutating every year they mutate. The best you can do ... is to smell the bullshit. Even if you know nothing about science if you are a "real person" you can count that we have countless viruses sweeping through the country why all this bullshit nonsense. Surely when 600,000 die every year in the UK, every single year, and many of viruses ... why worry if another 60,000 or 200,000 die in a particular year. It's just a bad year. And are we really supposed to believe that a virus that acts like any other flu ... i.e. waves come and go ... is anything to worry about? The entire world survives quite well for hundreds of thousands of years ... and now ... we are supposed to ... what? To end society? The bullshit is piling up quite highly science or no science. The only question is ... do you have any self-respect. Forget about the science, you won't ever be able to understand it - if you are going to come to a conclusion it will be without the science. 2 1 Quote Link to comment Share on other sites More sharing options...
Mr H Posted December 19, 2020 Share Posted December 19, 2020 17 hours ago, rideforever said: @Mr H Ultimately you will personally get screwed unless you personally become intelligent. Right now all you can do is play one person off another one because you don't really understand any of the above detailed bullshit. I can point out various bullshits about the above but it doesn't mean anything to you - after all why would you trust me. At least those people are "scientists", right ? It's interesting we are discussing whether one particular virus exists or not ... whilst all day long viruses of all sorts are sweeping through the world. Like the many flus sweeping through the UK right now, and mutating every year they mutate. The best you can do ... is to smell the bullshit. Even if you know nothing about science if you are a "real person" you can count that we have countless viruses sweeping through the country why all this bullshit nonsense. Surely when 600,000 die every year in the UK, every single year, and many of viruses ... why worry if another 60,000 or 200,000 die in a particular year. It's just a bad year. And are we really supposed to believe that a virus that acts like any other flu ... i.e. waves come and go ... is anything to worry about? The entire world survives quite well for hundreds of thousands of years ... and now ... we are supposed to ... what? To end society? The bullshit is piling up quite highly science or no science. The only question is ... do you have any self-respect. Forget about the science, you won't ever be able to understand it - if you are going to come to a conclusion it will be without the science. Yes you are spot on. Thanks for the post. Quote Link to comment Share on other sites More sharing options...
Macnamara Posted December 19, 2020 Share Posted December 19, 2020 God bless you Jon...that you were out there in the 1980's compiling that info about vaccine damage like a voice in the wilderness... Posted by Jon Rappoport Posted on 19 December 2020 Some 40 freedom of information requests all over the world asking for evidence that SarsCoV2 exists have produced NO EVIDENCE that it exists. Why? Because it DOESN’T! First of all, very high praise goes to Christine Massey, for her work in exposing the coronavirus fraud. In a half-sane world, she would have received many awards by now. Her latest communication reads: “Freedom of Information reveals Public Health Agency of Canada has no record of ‘SARS-COV-2’ isolation performed by anyone, anywhere, ever” [1] I urge readers to visit Massey’s site and read her new article and follow all the links. Her findings are stunning. She and her team have made about 40 FOI requests to public health agencies in various countries, requesting proof that SARS-CoV-2 has been isolated. You’ll see from the responses that not one agency has records demonstrating isolation. This means exactly what it seems to mean: the virus has not been proven to exist. As for the people who keep chanting that the virus has been isolated, I can keep explaining why this is not so. I can do this forever. [2] [3] Whether it’s a scientist, a gaggle of scientists, a government official, a person waving a study around like a newspaper with a hot headline from an old movie, my response is the same, and I make it knowing that some people will intentionally refuse to understand it: ONE: SAYING the virus has been isolated is not the same thing as proving it’s been isolated. TWO: Researchers routinely twist the meaning of the word “isolated” to mean its very opposite. Isolation is absurdly taken to mean: “We have the virus in a soup in a dish in the lab. It is not separated out (isolated) from the soup. The soup contains various cells—human, monkey—and an array of (toxic) chemicals and drugs. We know the virus is there, because it is infecting and killing some of the cells.” A reasonably bright junior high school student would immediately realize this is not a description of isolation. A reasonably bright high school student would point out that there is no proof the virus is infecting and killing cells, because the toxic chemicals and drugs in the soup are sufficient to do the cell-killing. He might also mention the cells in the soup are being starved of nutrients, and this alone could cause their death. Therefore, there is no evidence that “the virus” is actually in the soup. Therefore, there is no evidence in this situation for claiming the virus exists at all. On to the next factor: the ever-present claims of having “sequenced the genetic structure of the virus.” Again, SAYING the sequencing has been achieved is not the same thing as proving it. And proving it is impossible, if you don’t already have the virus in a purified and isolated state. Instead of proof, you have shady inference and assumption and guesswork and deception. How can you sequence something you don’t have? You can’t. I’ve used several analogies to explain this nonsense. Here is another one: An art restorer, conservationist, and historian is called to the home of a well-known mob enforcer. The enforcer tells him he has something to show him in the attic. On the way, they pass through the living room, where several open suitcases are sitting on the floor. They’re spilling over with stacks of cash. Automatic weapons and boxes of ammo are laid out on a long table. In an open closet, the art expert sees a row of jackets with designations indicating: FBI, BATF, Federal Marshal, sheriff, local police. In the attic, the mob enforcer points to a small pile of tiny chips on the floor. “These are from a lost Rembrandt self-portrait,” he says. “Collect them, go to work on them, give me a favorable report. Or else.” Back in his lab, the obedient art expert quickly divides the chips into three groups. The first group is water-color chips from a child’s toy set. The second group is mid-20th-century acrylic chips. The third group is lead white chips, used for a hundred years on either side of the rough date when Rembrandt could have painted the lost self-portrait. The art expert finds that Rembrandt (and hundreds of other painters) used this general type of lead white. The expert constructs, from other scholars’ work, an essay claiming there was and is a lost Rembrandt self-portrait. He excludes commentary that denies the existence of this painting. He “sequences” all this information and conjecture and guesswork (and con) into a convincing report, which points to the small pile of chips in the mob enforcer’s attic. (It turns out the enforcer intends to accuse a rival mob boss of stealing the “lost Rembrandt self-portrait.”) The existence of the self-portrait is thus “established,” which is to say, it is put together, cobbled from various sources, concocted, smoothed out by ignoring counter-information—employing a vast generality about lead white paint. Of course, in all this ridiculous invention, the self-portrait itself is not there, it is not in hand, its existence has not been demonstrated, it is a story, THERE IS NO ISOLATION OF IT from surrounding assumption and gimcrackery. So it is with SARS-CoV-2. Pieces of data that reference prior supposed RNA sequences in libraries are all strung together, to resemble what is claimed to be a new and unique coronavirus—without having the actual virus, without having shown it exists at all. In past articles, I’ve quoted two key documents, one from the CDC, and one from “the Drosten group.” These documents were describing how to perform the PCR test for the new virus—and in both documents, the authors state they don’t have the virus. So…a test for what? The virus you don’t have. All claims that these authors eventually DID obtain the virus are based on the crooked definition of “isolated” I’ve explained above. Yes, they got hold of “isolated virus,” meaning the soup in the dish in the lab—and we’re back where we began. Isolation meaning non-isolation. I’ve explained all this several times, in detail, in past articles, and of course people here and there continue to send me studies claiming isolation. I can do this forever. People can say, “Well, we know from photos of Martian soil samples that on the second Tuesday in March, 1843, there was a picnic on Mars attended by three virologists from the Martian Institute of Epidemiology, and they ate baloney sandwiches on rye toast and drank Miller Lite.” I enjoy these fictional tales in a vacuum. I would leave them alone, except that the failure to prove the existence of SARS-Cov-2 is at the bottom of all the lies that have been used to steal the freedom and assets and livelihoods from at least a billion people. I won’t leave that alone. Neither should you. “…but wait, Mr. Rappoport, here is a study from Outer Mongolia that states the virus has been isolated. This seems to settle the science on this issue, once and for all.” Sure. Sure it does. And the sun sets every day at noon in Cincinnati. https://davidicke.com/2020/12/19/some-40-freedom-of-information-requests-all-over-the-world-asking-for-evidence-that-sarscov2-exists-have-produced-no-evidence-that-it-exists-why-because-it-doesnt/ 1 Quote Link to comment Share on other sites More sharing options...
rs1978 Posted December 21, 2020 Share Posted December 21, 2020 Hello my friend I also i'm in the same boat simple question . Is what david says about the virus never been isolated to prove it exists TRUE OR NOT ! I follow David and hold him in high regard also. But i have worked with people who know people that are in hospital on ventilators ! also about the PCR test . i get that is a lot of crap it doesn't test for infectious deceases . I have fell out with family members /friends my partner as i am awake to the SCANdemic that is really going on HOWEVER , my step kid for example and my own kid ages 12 and 3 , where chalk white and looked like they had a cold etc , my gf sent out tests to get them tested which i refused but what can you do she done it anyways so im expecting ths will come back positive knowing that these tests are testing you for generic material and there being amplified etc so i think here we go but both times the tests have came back negative ! IS THERE A DEADLY VIRUS THAT IS KILLING PEOPLE OR NOT ! as i says i am confused as david says its never bene isolated to prove it exists is THIS TRUE ! ? Quote Link to comment Share on other sites More sharing options...
Macnamara Posted December 22, 2020 Share Posted December 22, 2020 10 hours ago, rs1978 said: Is what david says about the virus never been isolated to prove it exists TRUE OR NOT ! We know that the PCR test doesn't detect the full genome of a virus, it just detects snippets of genetic material. The whole lockdown is based on people testing positive for the PCR test but if they are false positives then this is churning out false cases i n which case the lockdown is not justified As for the existence of a novel coronavirus, shouldn't the burden of proof be on the government to prove its existence before placing the entire country under house arrest? Otherwise any government can make any claim they like whenever they like to justify anything they like. They need to provide evidence 10 hours ago, rs1978 said: But i have worked with people who know people that are in hospital on ventilators ! Its very possible that through a process called 'molecular mimicry' the flu vaccine has been causing peoples immune systems to turn on themselves. This reaction could then be labelled 'covid' when they present at the hospital. The following study claims a link between flu vaccination roll out and resultant 'covid' symptoms in the elderly: Positive association between COVID-19 deaths and influenza vaccination rates in elderly people worldwide Christian Wehenkel October 1, 2020 Abstract Background The coronavirus disease 2019 (COVID-19) pandemic, caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), is an ongoing global health crisis, directly and indirectly impacting all spheres of human life. Some pharmacological measures have been proposed to prevent COVID-19 or reduce its severity, such as vaccinations. Previous reports indicate that influenza vaccination appears to be negatively correlated with COVID-19-associated mortality, perhaps as a result of heterologous immunity or changes in innate immunity. The understanding of such trends in correlations could prevent deaths from COVID-19 in the future. The aim of this study was therefore to analyze the association between COVID-19 related deaths and influenza vaccination rate (IVR) in elderly people worldwide. Methods To determine the association between COVID-19 deaths and influenza vaccination, available data sets from countries with more than 0.5 million inhabitants were analyzed (in total 39 countries). To accurately estimate the influence of IVR on COVID-19 deaths and mitigate effects of confounding variables, a sophisticated ranking of the importance of different variables was performed, including as predictor variables IVR and some potentially important geographical and socioeconomic variables as well as variables related to non-pharmaceutical intervention. The associations were measured by non-parametric Spearman rank correlation coefficients and random forest functions. Results The results showed a positive association between COVID-19 deaths and IVR of people ≥65 years-old. There is a significant increase in COVID-19 deaths from eastern to western regions in the world. Further exploration is needed to explain these findings, and additional work on this line of research may lead to prevention of deaths associated with COVID-19. https://peerj.com/articles/10112/ 1 Quote Link to comment Share on other sites More sharing options...
Firebird Posted December 26, 2020 Share Posted December 26, 2020 I think it exists because there are specific symptoms you usually don't find in the flu, like the dry cough and the loss of taste and smell. It's a new strain of corona. Quote Link to comment Share on other sites More sharing options...
CharlieBoy78 Posted December 28, 2020 Share Posted December 28, 2020 (edited) Quote What we are seeing now that seems to have been ignored is -- nano dust, fine dust particles nobody seems to know who, what, when, where or how that stuff is being blown across the world Have you heard of GeoEngineering? I can attest to that being the likely delivery method and on Christmas Day i went out to help my Dughter install her Camera into her Car only to turn around and see a lower than usual flight of one of these spraying Planes Now the weird thing [as i am used to seeing this happening and am very much informed by Dane Wiggington and his team] was that the spray coming out of the pnozzle spread differently than i have ever seen, it looked more liek a collection of smoke rings than a steady stream i am used to seeing. This whoel thing is a disgrace and i am sick of sitting here allowing this to continue, when are we gonna go enmasse to these miltary and civilian airlines and sort this shit out? Before long we'll all be too ill to do anything, this is crazier than the bastards doing it to us and we can all clearly see by now that nobody else is gonna help us. Edited December 28, 2020 by CharlieBoy78 Quote Link to comment Share on other sites More sharing options...
Beaujangles Posted December 28, 2020 Share Posted December 28, 2020 (edited) On 12/26/2020 at 12:21 PM, Firebird said: I think it exists because there are specific symptoms you usually don't find in the flu, like the dry cough and the loss of taste and smell. It's a new strain of corona. Several years ago I worked on a heart and lung ward. I saw many respiratory illnesses. I saw people die from them sometimes. It was not pretty...watching someone gasping for air is frightening even when you are used to it. But that was then... as I see it, nothing has changed. people get sick, they get chest infections that get worse ( especially if they do not go to a doctor because they are scared of a pandemic, like now!!!) Those infections become pneumonia, bronchitis, pleurisy, etc etc. Here are a few lung conditions...notice how they all have the alleged 'symptoms of covid'. Also read the 2009 link at the bottom in regard to loss of taste and smell - it explains about the nerve that causes this and this nerve is near the cribriform plate that is the membrane close to the brain, in fact its the area that is weakest between the nasal cavity and brain. This is the area that the obscene nasal swab being used in covid 'testing' goes back to...it can damage that area and that also will cause loss of taste and smell. People really need to understand lung conditions and realize that this new bullshit is simply that... I'll say its my opinion as a disclaimer...but I believe I am right in my opinion.: Pleurisy: The most common symptom of pleurisy is a sharp chest pain when breathing deeply. Sometimes the pain is also felt in the shoulder. The pain may be worse when you cough, sneeze or move around, and it may be relieved by taking shallow breaths. Other symptoms can include shortness of breath and a dry cough.Feb 14, 2020 Pneumonia: Signs and symptoms of pneumonia may include: Chest pain when you breathe or cough Confusion or changes in mental awareness (in adults age 65 and older) Cough, which may produce phlegm Fatigue Fever, sweating and shaking chills Lower than normal body temperature (in adults older than age 65 and people with weak immune systems) Nausea, vomiting or diarrhea Shortness of breath Bronchitis: Symptoms of acute bronchitis last less than 3 weeks and can include: Coughing with or without mucus. Soreness in the chest. Feeling tired (fatigue) Mild headache. Mild body aches. Sore throat. Emphysema: What are the symptoms of emphysema? Frequent coughing or wheezing. A cough that produces a lot mucus. Shortness of breath, especially with physical activity. A whistling or squeaky sound when you breathe. Tightness in your chest. https://www.chicagotribune.com/news/ct-xpm-2006-04-09-0604090306-story.html Edited December 28, 2020 by Beaujangles Quote Link to comment Share on other sites More sharing options...
skitzorat Posted December 28, 2020 Share Posted December 28, 2020 (edited) 3 hours ago, CharlieBoy78 said: Have you heard of GeoEngineering? I can attest to that being the likely delivery method and on Christmas Day i went out to help my Dughter install her Camera into her Car only to turn around and see a lower than usual flight of one of these spraying Planes Now the weird thing [as i am used to seeing this happening and am very much informed by Dane Wiggington and his team] was that the spray coming out of the pnozzle spread differently than i have ever seen, it looked more liek a collection of smoke rings than a steady stream i am used to seeing. This whoel thing is a disgrace and i am sick of sitting here allowing this to continue, when are we gonna go enmasse to these miltary and civilian airlines and sort this shit out? Before long we'll all be too ill to do anything, this is crazier than the bastards doing it to us and we can all clearly see by now that nobody else is gonna help us. The smirking psychopath, Global Health Tsar, Kill Gates has been funding geoengineering for ages. He literally wants to block out the sun by spraying chemical shit up there to help "combat global warming" You couldn't make this up! https://www.geoengineeringwatch.org/bill-gates-admits-to-geoengineering/ The block out the sun drive is recently new, but the US has been using geoengineering since the Vietnam war, look up "cloud seeding" I believe its been patented and everything. I think that it, and also HAARP, can be used to create the "extremes weather events" like the California droughts, hurricanes, they can use weather as a 'clean' targeted weapon like the recent floods in China and those storms that targeted all the crops in the Mid East states, I think they called it "derecho" or something... They're doing it here in New Zealand and big time in Aussie when I lived there -there's no escape, they prob do it in the poles too! lol - I watched them spraying the city skies in Sydney in the morning with shyte that fogs up and waffles down, by afternoon the city is covered in haze, After those tic-tac-toe lines disperse. Its done purely to poison us and every other living creature on Mother Earth directly, through breathing/absorption and indirectly by poisoning the food and water. Chem-trails, its been happening all my life, I was born in 83 and remember seeing I saw it here in NZ during the 90s when at high school. Our overlords are pure evil. That's the one thing I've never been more sure of.! Edited December 28, 2020 by skitzorat Quote Link to comment Share on other sites More sharing options...
atenea Posted December 29, 2020 Share Posted December 29, 2020 (edited) On 11/28/2020 at 10:06 AM, runaway said: How about this "proof" ? Lots of diagrams and other stuff on this page what I don't understand. Do you ? https://virologydownunder.com/sigh-yes-the-covid-virus-is-real/ Thanks for this. The attached picture (that is shown in the report on the link you mention) is exactly the same one that Dr. Kaufman used to say that this is an exosome, the natural immune response of our system when encountered with any pathogen, and they have called the exosome, the virus. Edited December 29, 2020 by atenea Quote Link to comment Share on other sites More sharing options...
.jpg.8081a54a3b74a5d1823dfac966666137.jpg)
.jpg.594f0ef23288ec5ab04539b2f8a8dbd4.jpg)
Recommended Posts
Join the conversation
You can post now and register later. If you have an account, sign in now to post with your account.
Note: Your post will require moderator approval before it will be visible.