MaryCochrane Posted August 28, 2020 Share Posted August 28, 2020 (edited) I believe that the covid virus has not been isolated listening to David and I was busy letting people know it wasn't iscolated and someone sent me this link. Can anyone tell me if its reliable? Thanks https://sunnybrook.ca/research/media/item.asp?c=2&i=2069&f=covid-19-isolated-2020&fbclid=IwAR21EAOY3aU_dKGXdNpujJLU0pg4jUUpC2gUGfrM8BN2laTm4c4bl-NCg1Y#.XmsmoGqClHs.twitter Edited August 28, 2020 by MaryCochrane 1 Quote Link to comment Share on other sites More sharing options...
Guest Gone Fishing... Posted August 28, 2020 Share Posted August 28, 2020 11 minutes ago, MaryCochrane said: I have believed that the virus has not been isolated listening to David Icke but I have found this site that says they Isolatd it can anyone confirm please? https://sunnybrook.ca/research/media/item.asp?c=2&i=2069&f=covid-19-isolated-2020&fbclid=IwAR21EAOY3aU_dKGXdNpujJLU0pg4jUUpC2gUGfrM8BN2laTm4c4bl-NCg1Y#.XmsmoGqClHs.twitter No precise details in that article. Baseless claim IMO.. Quote Link to comment Share on other sites More sharing options...
Kala Namak Posted August 28, 2020 Share Posted August 28, 2020 I've seen several articles since the the start of this "pandemic" saying that the virus has been isolated... https://www.cdc.gov/coronavirus/2019-ncov/lab/grows-virus-cell-culture.html https://www.ecdc.europa.eu/sites/default/files/documents/covid-19-supply-substances-human-origin.pdf https://www.cebm.net/covid-19/sars-cov-2-orofecal-transmission/ https://www.nature.com/articles/s41586-020-2313-x 1 Quote Link to comment Share on other sites More sharing options...
MaryCochrane Posted August 28, 2020 Author Share Posted August 28, 2020 Thanks but I found my answer listing to David here https://davidicke.com/2020/08/28/the-nest-of-vipers-at-corruption-inc-david-icke-dot-connector-videocast-please-share-to-avoid-censorship/ Quote Link to comment Share on other sites More sharing options...
Mitochondrial Eve Posted August 28, 2020 Share Posted August 28, 2020 (edited) 24 minutes ago, MaryCochrane said: I believe that the covid virus has not been isolated listening to David and I was busy letting people know it wasn't iscolated and someone sent me this link. Can anyone tell me if its reliable? Thanks https://sunnybrook.ca/research/media/item.asp?c=2&i=2069&f=covid-19-isolated-2020&fbclid=IwAR21EAOY3aU_dKGXdNpujJLU0pg4jUUpC2gUGfrM8BN2laTm4c4bl-NCg1Y#.XmsmoGqClHs.twitter I agree with BC that this appears to be a baseless claim from Sunnybrook Research Institute. You can find some responses to Sunnybrook Research Institute's claims on the following link in the comments: https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless/ Quote the first link speaks of a mix and match of some genetic data from a guy with a cough with existing data from some other dataset that was equally meaningless. it also post dates the initial fraudulent pcr test the whole scheme was based on. that is not isolation. https://youtu.be/MnSYe5J6nMg and... Quote At the end of May someone in Toronto, Canada made a Freedom of Information (FOI) request to Sunnybrook Hospital in Toronto that you quote above along with FOI request to Health Canada and to the National Research Council in Canada requesting any records of isolation of the virus. Her FOI requests were NOT limited to records of isolation performed by the respective institution, or of records authored by the respective institution, rather they were open to any records describing “COVID-19 virus” isolation performed by anyone, ever, anywhere on the planet. The replies came back a couple of weeks ago (mid July, after two months) Every institution indicated the same: that they searched and could locate no record describing the isolation of any “COVID-19 virus”. To read the link to the actual post below: Toronto Sunnybrook https://www.fluoridefreepeel.ca/university-of-toronto-sunnybrook-hsc-have-no-record-of-covid-19-virus-isolation/ Health Canada https://www.fluoridefreepeel.ca/health-canada-has-no-record-of-covid-19-virus-isolation/ and... Quote There was no paper. There was a press article claiming isolation and purification. It was fiction. Sunnybrook is funded by the US government and private industry. Edited August 28, 2020 by Mitochondrial Eve 1 Quote Link to comment Share on other sites More sharing options...
MaryCochrane Posted August 28, 2020 Author Share Posted August 28, 2020 The department of health in Britain says you cannot Isolate the virus it is impossible! Viruses are obligate pathogens and cannot be grown or isolated without infecting a host There are many saying that its Isolated but it is impossible! Thanks everyone! 1 Quote Link to comment Share on other sites More sharing options...
Kala Namak Posted August 28, 2020 Share Posted August 28, 2020 1 minute ago, MaryCochrane said: The department of health in Britain says you cannot Isolate the virus it is impossible! Viruses are obligate pathogens and cannot be grown or isolated without infecting a host There are many saying that its Isolated but it is impossible! Thanks everyone! Indeed, the reports claiming isolation have very little in the way of detail, and expect the reader to trust the word of "reputable" organisations. I'm with Kaufmann on this one. 5 Quote Link to comment Share on other sites More sharing options...
MaryCochrane Posted August 28, 2020 Author Share Posted August 28, 2020 Great forum Thank you all for the info I was looking for 1 Quote Link to comment Share on other sites More sharing options...
Grumpy Owl Posted August 28, 2020 Share Posted August 28, 2020 22 minutes ago, Basket Case said: No precise details in that article. Baseless claim IMO.. There's a strong emphasis on the word 'collaborate' in that press release. 1 Quote Link to comment Share on other sites More sharing options...
Guest Gone Fishing... Posted August 28, 2020 Share Posted August 28, 2020 @Jamieson See above.. Quote Link to comment Share on other sites More sharing options...
wingwang Posted August 28, 2020 Share Posted August 28, 2020 Here's a more detailed version of the link in the OP's post: https://wwwnc.cdc.gov/eid/article/26/9/20-1495_article Quote Quantitative Real-Time PCR To detect SARS-CoV-2 in cell culture supernatant, we removed 140 μL of supernatant and performed detection of viral nucleic acids by reverse transcription PCR (RT-PCR), following an adaptation of the Corman et al. protocol (9). In brief, we extracted viral RNA from infected cells by using a QIAamp viral RNA kit (QIAGEN, https://www.qiagen.comExternal Link) according to the manufacturer’s instructions. The RT-PCR reactions were conducted by using Luna Universal qPCR Master Mix (New England Biolabs, https://www.neb.caExternal Link) according to the manufacturer’s instructions. Two separate gene targets were used for detection, the 5′ untranslated region (UTR) and the envelope (E) gene. Primers and probes used were 5′ UTR forward GTTGCAGCCGATCATCAGC, 5′ UTR reverse GACAAGGCTCTCCATCTTACC, and 5′ UTR probe FAM-CGGTCACACCCGGACGAAACCTAG-BHQ-1; and E-gene forward CAGGTACGTTAATAGTTAATAGCGT, E-gene reverse ATATTGCAGCAGTACGCACACA, and E-gene probe CAL Fluor Orange 560-ACACTAGCCATCCTTACTGCGCTTCG-BHQ-1. The cycling conditions were 1 cycle of denaturation at 60°C for 10 min, then 95°C for 2 min, followed by 44 amplification cycles at 95°C for 10 s and 60°C for 15 s. Analysis was performed by using Rotor-Gene Q software (QIAGEN) to determine cycle threshold (Ct). So again, they used the PCR test! Guffaw! And they used more amplification cycles than the Tour of blinking France! 1 Quote Link to comment Share on other sites More sharing options...
rideforever Posted August 28, 2020 Share Posted August 28, 2020 (edited) Regarding this paper: - They say they have 2 patients who have Covid19. How do you know they have Covid19? Doesn't say. I hope it's not that some doctor guessed they did because they had the flu in 2020. - They are not isolating or working with a "virus", they are swabbing part of the nasal passages and collecting everything up there and sticking it in a petry dish ... well a lot of things are in snot, not just a "virus" ... so there is no attempt at isolation. Isolation means on its own and not in a soup of snot. - Then they perform a test on these two snot cultures which they say have got a lot of some particular genes in them > that's the picture with the 6 brown squares on it. So basically they take snot from 2 people, remix it in two petry dishes and when they run a test they find that both cultures have something in them. Which they say is Covid19. Hmm, just a few problems with this one. BTW their "control" is an empty dish with nothing in it ... this is not a satisfactory scientific control. This is very telling, because the control has to be interfered with the same amount as the other petry dishes for it to be valid ... for instance by putting in the snot of a 3rd person and compare it to the snot of person 1 and 2. But they didn't do that. Perhaps they were afraid that the 3rd person's petry dish would also test positive for those genes. and so just left it blank This is very dodgy and not scientific. Well, regarding Koch's Postulates ... firstly you need to isolate a pathogen not collect snot which has lots of things in it. Secondly if you say these 2 patients have Covid19, you better have a damn good reason and not a hunch. Thirdly if you want to test your cultured snot for something then you need a control group and not an empty petry dish. Fourthly if your cultures snot does test form some range of genes you better have a good reason for using those ranges of genes other than ... the WHO told me to. It is very difficult to read the paper as it is so full of mumbo jumbo. This should tell you it's nonsense. The truth is always straightforward as long as you know what it is. These people are not scientists, they are not interested in discovery or reason ... they are simply using a lot of high tech expensive equipment in order to conclude what they are expected to conclude so that they can work their way up the greasy pole. Edited August 28, 2020 by rideforever 2 1 Quote Link to comment Share on other sites More sharing options...
Michael Timothy Babb Posted October 7, 2020 Share Posted October 7, 2020 Can U Medically even catch a virus? The human body when it detoxes itself creates many virus... The only way U can actually contract a worldly virus according to studied medicine is if it is Inject into U... Me thunks Veeve bean lyiiiied twouuuuu.... < Edgumacation of it all and such. 1 Quote Link to comment Share on other sites More sharing options...
Sunny_Leslie Posted October 9, 2020 Share Posted October 9, 2020 I very often hear that this coronavirus was created artificially and then they simply could not stop it during the tests. You can believe it. I just do not understand how they wanted to restrain him? People cannot be locked in their homes for life - they will still go to the store to shop, contact someone. It has been said more than once that Bill Gates wants to reduce the world's population. Did you think this virus is 100% the right way? Look how fast it is transmitted! Yes, the mortality rate is not high, but hospitals simply cannot cope with the number of cases, there are not enough doctors. I may be wrong in my assumptions, I am not an expert. But this whole story looks strange. I think that even those who do not believe in the conspiracy think about this oddity. Quote Link to comment Share on other sites More sharing options...
Macnamara Posted October 9, 2020 Share Posted October 9, 2020 The Smoking Gun: Where is the proof that the ‘virus’ exists? The CDC says it isn’t available. (This is the scam: Fake ‘virus’ + fake test + fake death certificates = fake pandemic) Posted by Jon Rappoport Posted on 9 October 2020 The CDC document is titled, “CDC 2019-Novel Coronavirus (2019-nCoV) Real-Time RT-PCR Diagnostic Panel.” It is dated July 13, 2020. Buried deep in the document, on page 39, in a section titled, “Performance Characteristics,” we have this: “Since no quantified virus isolates of the 2019-nCoV are currently available, assays [diagnostic tests] designed for detection of the 2019-nCoV RNA were tested with characterized stocks of in vitro transcribed full length RNA…” The key phrase there is: “Since no quantified virus isolates of the 2019-nCoV are currently available…” Every object that exists can be quantified, which is to say, measured. The use of the term “quantified” in that phrase means: the CDC has no measurable amount of the virus, because it is unavailable. THE CDC HAS NO VIRUS. A further tip-off is the use of the word ‘isolates.” This means NO ISOLATED VIRUS IS AVAILABLE. Another way to put it: NO ONE HAS AN ISOLATED SPECIMEN OF THE COVID-19 VIRUS. NO ONE HAS ISOLATED THE COVID-19 VIRUS. THEREFORE, NO ONE HAS PROVED THAT IT EXISTS. As if this were not enough of a revelation to shock the world, the CDC goes on to say they are presenting a diagnostic PCR test to detect the virus-that-hasn’t-been-isolated…and the test is looking for RNA which is PRESUMED to come from the virus that hasn’t been proved to exist. And using this test, the CDC and every other public health agency in the world are counting COVID cases and deaths…and governments have instituted lockdowns and economic devastation using those case and death numbers as justification. If people believe “you have the virus but it is not available,” and you have the virus except it is buried within other material and hasn’t been extracted and purified and isolated, these people believe the moon is made of green cheese. This is like saying. “We have the 20 trillion dollars, they are contained somewhere in our myriad accounts, we just don’t know where.” If you don’t know where, you don’t know you have the money. “The car keys are somewhere in the house. We just don’t where.” Really? If you don’t know where, you don’t know the keys are in the house. “The missing cruise missile is somewhere in the arsenal, we just don’t where.” No. If you don’t know where, you don’t know the missile is in the arsenal. “The COVID-19 virus is somewhere in the material we have—we just haven’t removed it from that material. But we know what it is and we’ve identified it and we know its structure.” NO YOU DON’T. YOU ASSUME THAT. Science is not assumptions. “But…but…there is a study which says a few researchers in a lab isolated the virus…” They say they did. But in July, the CDC is saying no virus is available. I guess that means trucks were not available to bring the virus from that lab to the CDC. The trucks were out of gas. It was raining. The bridge was washed out. The trucks were in the shop. Joe, the driver, couldn’t find his mask, and he didn’t want to leave home without it… Science is not assumptions. The pandemic is a fraud, down to the root of the poisonous tree. https://davidicke.com/2020/10/09/the-smoking-gun-where-is-the-proof-that-the-virus-exists-the-cdc-says-it-isnt-available-this-is-the-scam-fake-virus-fake-test-fake-death-certificates-fake-pandemic/ 1 Quote Link to comment Share on other sites More sharing options...
rooey Posted October 10, 2020 Share Posted October 10, 2020 they want us to believe in whatever virus and their system, that we need researchers working around the clock to come up with solutions bla bla Quote Link to comment Share on other sites More sharing options...
DarianF Posted November 2, 2020 Share Posted November 2, 2020 The CDC claim they have isolated it, and are growing the virus in cell culture. Quote Link to comment Share on other sites More sharing options...
runaway Posted November 28, 2020 Share Posted November 28, 2020 (edited) How about this "proof" ? Lots of diagrams and other stuff on this page what I don't understand. Do you ? https://virologydownunder.com/sigh-yes-the-covid-virus-is-real/ Edited November 28, 2020 by runaway Quote Link to comment Share on other sites More sharing options...
sherbet Posted December 15, 2020 Share Posted December 15, 2020 Hi I've been following David for years now and I like many others hold him in high regard. However right now I feel confused on who to take on board as far as this virus is concerned and if David can clear this up for me I'd be eternally grateful. My query is this. David states that no C19 has not been isolated so therefore doesn't exist. I have read the CDC papers which state they have no isolate so I take Davids word here as verified. However, there is a Dr Francis Boyle, an expert in biological warfare who states that the virus has been examined under an electron microscope and it's shown to have the HIV delivery system which has now led to Australia halting their vaccine program due to some people showing signs of HIV due to how the vaccine is manufactured. Could someone clarify, DOES THIS VIRUS EXIST OR NOT as this is adding to all the confusion out there 1 Quote Link to comment Share on other sites More sharing options...
Grumpy Owl Posted December 15, 2020 Share Posted December 15, 2020 Who is Robert McKenzie and what does he have to do with this? Quote Link to comment Share on other sites More sharing options...
sherbet Posted December 16, 2020 Share Posted December 16, 2020 12 hours ago, Grumpy Owl said: Who is Robert McKenzie and what does he have to do with this? I am Robert McKenzie. I am sovereign citizen of this country who is going through this with everyone else that what I have to do with this. I am a health professional who has been researching C19 since it's inception. I asked an open and honest question based on my information and now you seem to be interested in debasing me. Well done Grumpy Owl. Shame on you. Especially on Davids site which I always thought had forward thinking viewers. For your information why don't you investigate Dr Francis Boyle and others who reported having isolated the virus. Quote Link to comment Share on other sites More sharing options...
Steph Posted December 16, 2020 Share Posted December 16, 2020 19 hours ago, sherbet said: Hi I've been following David for years now and I like many others hold him in high regard. However right now I feel confused on who to take on board as far as this virus is concerned and if David can clear this up for me I'd be eternally grateful. My query is this. David states that no C19 has not been isolated so therefore doesn't exist. I have read the CDC papers which state they have no isolate so I take Davids word here as verified. However, there is a Dr Francis Boyle, an expert in biological warfare who states that the virus has been examined under an electron microscope and it's shown to have the HIV delivery system which has now led to Australia halting their vaccine program due to some people showing signs of HIV due to how the vaccine is manufactured. Could someone clarify, DOES THIS VIRUS EXIST OR NOT as this is adding to all the confusion out there This is going to blow your mind but the AIDS delivery system is the Cancer delivery system, is the TB delivery system, is the thing you 'health care professionals' are too wrapped up in the bullshit of those you daren't offend keeping your work pride levels so high you don't see the shot being fired beneath the radar. The cure is the curse! Just like cancer patients clinging to their radium pills and neutron beam therapies in the hope of being cured of the symptoms radioactive exposure produces. The 'treatment' for those diagnosed with AIDS is the introduction of drugs which suppress the immune system by doctors clinically managing patients in research programs not that dissimilar to the works of Josef Mengeles and the Nazi colleagues of Sigmund Freud. The patient trust in the doctor is important you understand. Is the doctor a fucking idiot to hide behind jargon when faced with a requirement to acknowledge the bleeding obvious? A good bedside manner is not a human face but a corporate whore which can only say so much. You know yourself there are things you cant say to the patients. Try bringing this type of subject up at the centre stage of a medical conference. You'll soon see just how far from savagary those professional reputations can be. You think faith healing is about magic powers? Put a dandelion petal in a glass of water and boil it until the petal turns to some thing like wet paper. Remove the petal and evaporate the water to 1% left. Dissolve the water in a gallon of water and evaporate this so theres only a glass left. No spiritual charging has taken place if you know about that, its a purely herbal/chemical solution which is a remedy to cancer. There's another remedy available which involves radium, xenon gas, neutron beams, proton beams (alpha/beta radiation to a 5th year schoolie). Two patents. One of them takes the ludicrously dissolved dandelion petal water and another is ludicrously exposed to radiation through chemo and energy beams. Which treatment will be least conducive to preventing tumours? Theres "allegedly intelligent" men who believe the radioactive exposure is less condusive to tumours than 0.00001% dandelion petal oil. How silly is that? Who would believe us? Only the fairies in our brain we pray for incase Elon Musk brings about the age of worship of the nanobots! May the force be with you young skywalker! Quote Link to comment Share on other sites More sharing options...
Steph Posted December 16, 2020 Share Posted December 16, 2020 Hoffman Lenses- Mystery.mp4 3 Quote Link to comment Share on other sites More sharing options...
Guest Gone Fishing... Posted December 16, 2020 Share Posted December 16, 2020 6 hours ago, sherbet said: I asked an open and honest question based on my information and now you seem to be interested in debasing me. Well done Grumpy Owl. Shame on you. @Grumpy Owl Grumpy was only asking how Robert McKenzie was connected in relation to your post. You didn't make yourself clear.. BC Quote Link to comment Share on other sites More sharing options...
Grumpy Owl Posted December 16, 2020 Share Posted December 16, 2020 11 hours ago, sherbet said: I am a health professional who has been researching C19 since it's inception. I asked an open and honest question based on my information and now you seem to be interested in debasing me. Well done Grumpy Owl. Shame on you. Especially on Davids site which I always thought had forward thinking viewers. Hello @sherbetand welcome to the forum. I asked the question because it helps greatly if discussion topics/threads are started here with a suitable/appropriate topic (subject) title. Also it is advisable not to reveal any personal information about yourself unless you are really comfortable doing so. Quote Link to comment Share on other sites More sharing options...
Recommended Posts
Join the conversation
You can post now and register later. If you have an account, sign in now to post with your account.
Note: Your post will require moderator approval before it will be visible.